شناسایی ژن‌های blaTEM، blaSHV و blaOXA در جدایه‌های اشریشیا کلی جمع‌آوری شده از کلی‌باسیلوز طیور با استفاده از روشMultiplex-PCR

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانش آموخته کارشناسی ارشد، گروه میکروبیولوژی، واحد سیرجان، دانشگاه آزاد اسلامی، سیرجان، ایران.

2 استادیار گروه میکروب شناسی، واحد تهران شمال، دانشگاه آزاد اسلامی، تهران، ایران.

3 استادیار گروه میکروبیولوژی، دانشکده علوم پایه، واحد ساوه، دانشگاه آزاد اسلامی، ساوه، ایران.

چکیده

چکیده
   مقاومت ضدمیکروبی ایجاد شده به­واسطه تولید آنزیم­های بتالاکتاماز وسیع­الطیف (ESBLs) در اشریشیا کلی یک تهدید اساسی در کلی­باسیلوزیس ماکیان محسوب می­شود. مطالعه حاضر به شناسایی ژن­های blaTEM، blaSHVو blaOXAدر جدایه­های اشریشیا کلی به­دست آمده از کلی­باسیلوزیس طیور با استفاده از روش MPCR می­پردازد. در مجموع، 60 جدایه اشریشیا کلیاز طیور استان کرمان به­دست آمد. DNA سلولی با استفاده از کیت DNA-سیناژن (Cell culture, Tissues, Gram negative Bacteria and CSF) استخراج و PCR چندگانه به منظور شناسایی ژن­های OXA،SHVو TEMانجام شد. نتایج تست CDT نشان داد که 45 جدایه (75 درصد) مولد ESBLs بودند. تعداد 19 و 13 جدایه  (6/31 درصد و 6/21 درصد) ­به­ترتیب برای ژن­هایbla OXA و bla aada مثبت بودند. تعداد 7 جدایه (6/11 درصد) به­طور هم­زمان ژن­های OXA و aada را حمل می­کردند. تمام ایزوله­ها برای ژن­های TEM و SHV منفی بودند. نتایج نشان داد، با اینکه روشدیسکدیفیوژنبرایشناسایی ESBLs  روشیبسیارکاربردیو مقرونبهصرفهمی­باشد، ولی روش جدید طراحی­شده Multiplex-PCR در این مطالعه می­تواند به صورت روزمره در آزمایشگاه تشخیصی دامپزشکی برای شناسایی انتروباکتریاسه مولد بتالاکتاماز وسیع الطیف (ESBLs) به­کار رود.

کلیدواژه‌ها


عنوان مقاله [English]

Detection of bla TEM, bla OXA and bla SHV genes in Escherichia coli isolated from colibacillosis in poultry by multiplex-PCR

نویسندگان [English]

  • zohreh mehranifar 1
  • mitra salehi 2
  • kiyoumars amini 3
چکیده [English]

Abstract
   Antimicrobial resistance exhibited by extended-spectrum b-lactamases (ESBLs) production by E. coli is considered to be a major threat for colibacillosis in poultry. The present study deals with the detection of bla TEM, bla OXA and bla SHV genes in E. coli isolated from colibacillosis by MPCR.A total of 60 strains of E. coli were recovered from the poultry in Kerman, Iran. Cellular DNA was extracted by CinnaPure-DNA (Cell culture, Tissues, Gram negative Bacteria and CSF) and MPCR was performed for the identification of the OXA, SHV and TEM genes.CDT test results showed that 45 strains (75%) were noted for ESBL production. A total of 19 and 13 strains (31.6% and 21.6%) were positive for blaOXA and bla aada, respectively and 7 isolates (11.6%) carried both OXA and aada genes. All isolates were negative for TEM and SHV genes.The results showed, although disk diffusion is a highly practical and cost effective method for identification of ESBLs, but the novel multiplex PCR assay designed in this study may be routinely used in veterinary diagnostic laboratory for identification of extended spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae.

کلیدواژه‌ها [English]

  • ESBLs genes
  • E. coli
  • Multiplex-PCR
  • Colibacillosis

مقدمه

    اشریشیا کلی (Escherichia coli) یکی از اعضای فلور میکروبی در قسمت­های انتهایی روده پستاندران و پرندگان محسوب می­شود. اکثر جدایه­های این باکتری بیماری­زا نیستند، اما برخی از سروتیپ­های آن در پرندگان بیماری­هایی نظیر سپتی­سمی، عفونت کیسه زرده، تورم صفاق، تورم مجرای تخم، التهاب غشای مفاصل، تورم ناف، آبسه کف پا و تورم کیسه­های هوایی را ایجاد می­کنند. این بیماری­ها را در مجموع کلی­باسیلوزیس می­نامند (Lutful Kabir‎, 2010). این بیماری بیشتر در جوجه­های گوشتی بروز می­کند، اما ماکیان و بوقلمون­ها ممکن است دچار سپتی­سمی شوند. سپتی­سمی شدید­ترین حالت کلی­باسیلوزیس در پرندگان به­شمار می­آید (Haider et al., 2004). این بیماری به طروق مختلف ازجمله مدفوع، استنشاق، انتقال عمودی (تخمدان یا همان مادر به جوجه) و گوارش منتقل می­شود. این بیماری تلفات زیادی را در صنعت دامپروری ایجاد می­کند و در نتیجه سبب خسارات فراوان اقتصادی می­گردد (Caudry and Stanisich, 1979). برای جلوگیری از بروز چنین بیماری به­کارگیری بهترین شرایط پرورش و رعایت معیارهای بهداشتی به منظور به حداقل رساندن آلودگی تخم­مرغ ضروری می باشد. در اغلب حالات درمان علائم با استفاده از مایعات و پادزهرها صورت می­گیرد. همچنین از آنتی­بیوتیک­های مختلفی نظیر تتراسایکلین، کلرامفنیکل و بتالاکتام­ها جهت جلوگیری از کاهش تلفات ناشی از کلی­باسیلوزیس استفاده می­شود (Linton et al., 1977). در سال های اخیر افزودن آنتی­بیوتیک به زنجیره غذایی دام­ها، استفاده غیر اصولی، بیش از حد و خودسرانه از آنتی­بیوتیک­ها سبب بروز جدایه­های مقاوم از میکروب­ها شده که مشکلات اساسی را در دامپزشکی و همچنین پزشکی ایجاد کرده­اند، به­طوری­که معضل اصلی در این خصوص ظهور جدایه­هایی با مقاومت چند گانه (MDR) می­باشد (Al-Jasser, 2006). بتالاکتام­ها به­دلیل قدرت سمیت پایین برای سلول­های یوکاریوتی، طیف اثر گسترده و اثر ضد میکروبی قوی، از پرمصرف­ترین گروه آنتی­بیوتیکی محسوب می­شوند. بتالاکتامازها آنزیم­هایی هستند که با هیدرولیز هسته مرکزی حلقه بتالاکتام سبب غیرفعال شدن این آنتی­بیوتیک­ها می­شوند. یکی از مهم­ترین مکانیسم­های مقاومت نسبت به این آنتی­بیوتیک­ها تولید آنزیم­هایی تحت عنوان بتالاکتامازهای وسیع­الطیف (ESBLs) می‌باشد که این عوامل به طور عمده روی پلاسمیدها قرار دارند و این امر سبب تسهیل در گسترش این عوامل می­گردد (Schwaber et al., 2005). در سال 1980 آمبلر این آنزیم­ها را بر اساس توالی آمینواسیدی به 4 گروه (A-D) تقسیم‌بندی نمود که نوع B دارای جایگاه فعال روی (Zn2+) بوده و یک متالوبتالاکتاماز (MBLs) می­باشد (مهاجری و همکاران، 1390). نوع A همان بتالاکتامازهای وسیع­الطیف (ESBL) با جایگاه فعال سِرین و نوع C همان سفالوسپوریناز (AmpC) با جایگاه فعال سِرینی هستند. TEM و SHV سردسته آنزیم­های ESBLs (Extended spectrum beta-lactamase)، می­باشند که در گروه A از طبقه­بندی بتالاکتامازی آمبلر و کلاس be2 و b2 از طبقه­بندی بوش قرار دارند و از تغییر در سکانس یک یا چند اسیدآمینه در دو آنزیم فوق، دیگر آنزیم­ها حاصل می­شوند به گونه­ای که تا کنون 174 تحت­گونه از TEM و 119 تحت­گونه از SHV از سراسر جهان گزارش شده اند. این تغییرات سبب گرایش این دسته آنزیم­ها به سوبستراهای اختصاصی نظیر سفالوسپورین­های نسل سوم و چهارم به­ویژه سفوتاکسیم، سفتریاکسون و سفتازیدیم می­گردند  (مهاجری و همکاران، 1390). شایع­ترین نوع ESBLs در نمونه­های کلینیکی، نوع SHV می­باشد که ژن کدکننده آن پلاسمیدی بوده و بنابراین به راحتی در میان سویه جدایه­های باکتریایی منتشر می­شود (Al-Tawfiq, 2006). اولین SHV-1 در سال 1972 توسط پیتون کشف و تحت عنوان PIT-2 نام­گذاری شد که طبق تقسیم­بندی بوش در کلاس A قرار گرفت (Pitton‎, 1972). بتالاکتاماز­های SHV توسط کلاولانیک اسید مهار، اما توسط EDTA مهار نمی­شوند. اولین ESBL شناسایی شده، TEM می­باشد و انواع مختلفی از بتالاکتاماز نوع TEM با جابه­جایی در توالی اسید­های آمینه از TEM-1 به­وجود آمده­اند. TEM-1 به عنوان اولین بتالاکتاماز کد شده به­وسیله پلاسمید در انتروباکتریاسه­ها بود که سایر باکتری­ها از قبیل پسودوموناس آئروژینوزا نیز قادر به تولید آن هستند. بتالاکتامازهای نوع OXA در کلاس D مولکولی قرار می­گیرند و قادر به غیرفعال کردن اگزازولیل پنی­سیلین­ها مانند دی­کلوگزاسیلین، کلوگزاسیلین و اگزاسیلین هستند (Duttaroy and Mehta, 2005). به طور خلاصه مطالعات و گزارش­های متعدد حاکی از شیوع پراکنش این نوع مقاومت در اقصی نقاط دنیا بوده و موید یک مشکل جهانی است. بنابراین، هدف از مطالعه حاضر شناسایی ژن­های TEM، SHV و OXA در جدایه­های اشریشیا کلی به­دست آمده از کلی­باسیلوزیس طیور با استفاده از روشMPCR  می­باشد.

 

موارد و روش­ها

جمع­آوری نمونه و ایزولاسیون باکتری

   در این مطالعه تجربی، به مدت 12 ماه و در طول سال 1393 تعداد 60 نمونه از مدفوع طیور (ماکیان) با علایم مشکوک به کلی­باسیلوزیس از دانشکده دامپزشکی استان کرمان گردآوری شد. پس از هموژن کردن نمونه­های مدفوعی با محلول فسفات بافر (PBS)، جداسازی ذرات جامد و مواد خشک موجود در مدفوع، با استفاده از سانتریفیوژ با سرعت 3000 دور در دقیقه به مدت 5 دقیقه رسوب داده و فاز رویی (Supernatant) در ظروف استریل دیگری در دمای 4 درجه سانتی­گراد جمع­آوری گردید. سپس نمونه ها روی محیط معمول از قبیل مک­کانگی آگار، گزیلوز لیزین دزوکسی کولات (XLD)، سالمونلا شیگلا آگار (SSA) و تیوسولفات سیترات نمک صفرا سوکروز (TCBS) (مرک، آلمان) کشت و به مدت 24 ساعت در 37 درجه سانتی­گراد گرمخانه­گذاری شدند. به منظور شناسایی کلنی­های مشکوک به اشریشیا کلی با استفاده از تست­های استاندارد بیوشیمیایی و استاندارد نظیر MCA، EMB، ECC،E. coli Chrome Agar، کاتالاز، اکسیداز و استفاده از محیط­های افتراقی مانند TSI، SIM، MR-VP، سیمون سیترات، اوره آگار، نیترات آگار و تست‌های تکمیلی بیوشیمیایی مانند تخمیر قندها و استفاده از آمینواسیدها مورد استفاده قرار گرفت. بعد از تعیین گونه­های باکتری ‏E.coli، با آزمونهای بیوشیمیایی، جهت انجام آزمون آنتی­بیوگرام از روش دیسک دیفیوژن ‏‎(Disk ‎diffusion)‎‏ به روش کربی بائر و بر طبق دستورالعمل ‏CLSI‏ (Clinical and Laboratory Standards institute) ‏‎استفاده ‏گردید. تعدادی از کلونی باکتری را بوسیله آنس برداشته و در سرم فیزیولوژی استریل حل نموده تا برابر با کدورت استاندارد ‏نیم مک­فارلند گردد. سپس بر روی محیط مولر هینتون آگار کشت داده ودیسک های آنتی­بیوتیک با فاصله استاندارد بر روی ‏محیط کشت قرار داده و در دمای 37 درجه انکوبه گردیده و بعد از 24 ساعت نتایج قرائت گردید       (Cockerill, 2011).  ‏

Multiplex-PCR

   به منظور شناسایی ژن­های بتالاکتامازی، DNA ژنومی جدایه­ها با استفاده از کیت DNA-سیناژن (Cell culture, Tissues, Gram negative Bacteria and CSF) استخراج گردید. MPCR برای شناسایی ژن­های بتالاکتامازیSHV ، TEM  وOXA  با استفاده از پرایمرهای اختصاصی انجام شد (جدول 1) (Maynard et al., 2003). در نهایت، واکنش M-PCR به حجم نهایی25 میکرولیتر شامل 3/6 میکرولیتر PCR master mix 5X (سیناکلون، ایران) حاوی Taq DNA polymerase (0.05 U/µl)، MgCl2 (3 mM) وdNTPs (0.4 mM)، 9/0 میکرولیتر از هر یک از پرایمرها به غلظت 8/0 میکرومولار، 8/0 میکرولیتر از DNA الگو (10 نانوگرم) و 5/12 میکرولیتر آب دیونیزه استریل با استفاده از گرادیانت ترموسایکلر (اپندورف، آلمان) برای 35 سیکل به­صورت زیر انجام گرفت:

 یک سیکل 15 دقیقه در 95 درجه سانتی­گراد (دناتوراسیون اولیه)، سپس 30 سیکل شامل مرحله واسرشت شدن 30 ثانیه در 94 درجه سانتی­گراد، مرحله اتصال 25 ثانیه در 59 درجه سانتی­گراد و مرحله طویل شدن 60 ثانیه در 72 درجه سانتی­گراد و نهایتاً یک سیکل 10 دقیقه در 72 درجه سانتی­گراد. محصولات PCR از نظر حضور ژن­های مورد نظر روی ژل آگارز 1 درصد الکتروفورز شده و در نهایت با استفاده از اتیدیوم بروماید رنگ­آمیزی و با دستگاه UV لومیناتور با اشعه ماوراء بنفش بررسی، عکس­برداری و ضبط گردیدند. برای تمامی موارد، از سویه اشریشیا کلی استاندارد ATCC 25922 استفاده شد.

تحلیل آماری داده­ها

   داده­های آماری با نرم­افزار ‏SPSS‏ نسخه 19 و با استفاده از آزمون­های آماری توصیفی مورد تحلیل قرار گرفت.‏

 

 

 

جدول 1- توالی اولیگونوکلئوتیدی پرایمرهای اختصاصی مورد استفاده Multiplex-PCR

جدول پرایمرهای مورد استفاده

اندازه باند

(bp)

ژن هدف

توالی پرایمر   (3          5)

پرایمر

857

TEM

GAGTATTCAACATTTTCGT ACCAATGCTTAATCAGTGA

blaTEM-F
blaTEM-R

768

SHV

TCGCCTGTGTATTATCTCCC
CGCAGATAAATCACCACAATG

blaSHV-F
blaSHV-R

198

OXA

GCAGCGCCAGTGCATCAAC
CCGCATCAAATGCCATAAGTG

blaOXA-F
blaOXA-R

284

aadA

TGATTTGCTGGTTACGGTGAC

CGCTATGTTCTCTTGCTTTTG

aadA-F

aadA-R

 

 


 

 

 

 

 

 

یافته‌ها

جدایه­های باکتریایی و تست حساسیت آنتی­بیوتیکی

   بر اساس روش­های بیوشیمیایی و میکروبیولوژیکی استاندارد، در مجموع تعداد 60 سویه اشریشیا کلی از طیور دارای علایم اسهال و مشکوک به کلی باسیلوزیس جمع­آوری گردید. به منظور شناسایی جدایه­های مولد ESBLs از روش CDT استفاده شد که 45 ایزوله (75%) داراری فنوتیپ ESBLs مثبت بودند (جدول 2). همچنین در تعدادی از جدایه­های تحت بررسی فنوتیپ مقاومت به چند آنتی بیوتیک (MDR) مشاهده شد (جدول 2).

 

 

جدول 2- تعداد (درصد) فراوانی جدایه­های اشریشیا کلی مقاوم به چند دارو (MDR)

سویه های با مقاومت چند داروئی

مقاوم به 9

آنتی­بیوتیک

مقاوم به 8

آنتی­بیوتیک

مقاوم به 7

آنتی­بیوتیک

مقاوم به 6

آنتی­بیوتیک

مقاوم به 5

آنتی­بیوتیک

مقاوم به 4

آنتی­بیوتیک

مقاوم به 3

آنتی­بیوتیک

(6%) 4

(11%) 7

(16%) 10

(21%) 13

(25%) 15

(31%) 19

(45%) 27

 


شناسایی ژن­های بتالاکتامازی

   از میان 60 جدایه E. coli، 32 جدایه از لحاظ تولید آنزیم­های بتالاکتامازی وسیع الطیف مثبت بودند، که 19 سویه (6/31%) حامل ژن bla OXA، 13 جدایه  (6/21%) دارای ژن بتالاکتاماز bla aadaبودند. در این مطالعه ژن­هایbal  TEM و bla SHV در هیچ­کدام از نمونه ها (0/0%) شناسایی نشد (شکل 1).

 

 

 

                    شکل 1- نتایج آزمون M-PCR از چپ به راست: Ladder 100bp – C+؛ کنترل مثبت-

C-                         ؛ کنترل منفی- باند bp 198 بتالاکتاماز OXA، باند bp 284 بتالاکتاماز aada.

 


 

 

بحث و نتیجه‌گیری

   شیوع بالای بیماری­های تنفسی پرندگان همه ساله خسارات قابل توجهی را به صنعت پرورش طیور کشور وارد می­کند که بیماری­های باکتریایی و در رأس آنها عفونت­های ناشی از باکتری اشریشیا کلی سهم عمده­ای در بروز این مشکل دارند (Turtura‎ et al., 1990). عبدالهی خیرآبادی و همکاران در سال 1391 نشان دادند که ایمی­پنم و سیپروفلوکساسین از جمله داروهای شاخص در درمان عفونت­های ناشی از اشریشیا کلی هستند (‎‎عبدالهی خیرآبادی و همکاران، 1391). بنابراین، این آنتی­بیوتیک را می­توان به عنوان آنتی­بیوتیک انتخابی (Therapeutic Choices) معرفی نمود، اما تفاوت در نتایج تست حساسیت آنتی­بیوتیکی می­تواند به علت تفاوت در نوع نمونه (نمونه انسانی در مقایسه با نمونه دامی و اندیکاسیون دارو در این نمونه­­ها) باشد (امیری و همکاران، 1394؛ بابایی و همکاران، 1391). همچنین به منظور شناسایی جدایه­های مولد ESBLs از روش CDT استفاده شد که 45 ایزوله (75%) دارای فنوتیپ ESBLs مثبت بودند. این یافته با نتایج مطالعه اسلامی و نجار پیراهه هم­خوانی دارد (اسلامی و نجارپیرایه، 1391). آنالیز مولکولی ژن­های بتالاکتامازی نشان داد که 32 سویه (3/53%) دارای ژن بتالاکتاماز بودند. بیشترین و کمترین فراوانی ژن­های بتالاکتامازی تحت مطالعه به ترتیب مربوط به bla OXA(19 جدایه، 6/31%) و bla aada (13 جدایه، 6/21%) می­باشد. همچنین در 7 جدایه (6/11%) حضور هم­زمان دو ژن bla OXAو bla aadaبه اثبات رسید. در این مطالعه ژن­های bla  TEMوbla SHV   در هیچ­کدام از نمونه­ها ردیابی نشد. مطالعات فراوانی روی ژن­های مقاومت آنتی­بیوتیکی انجام شده که به­عنوان مثال می­توان به فراوانی ژن TEM در ترکیه (72%) و هند (30%) اشاره کرد (Rawat and Nair, 2010; Baiget al., 2014 ‎). مسجدیان جزی و همکاران  در سال 1386 در اصفهان، فراوانی ژن  TEMرا 84/6% گزارش کردند (مسجدیان جزی و همکاران، 1386)، که در مطالعه حاضر این ژن در جدایه­های اشرشیا کلی شناسایی نشد. برادفورد و همکاران نـشان دادند کـه بیـشترین فراوانـی آنـزیم­هـای  ESBLsدر ایــالات متحــده، مربــوط بــه خــانواده TEM  بتالاکتامــاز می­باشد (Bradford, 2001). قنبرپور و همکاران، 100 سویه اشریشیا کلی به­دست آمده از پریکارد جوجه­های گوشتی مبتلا به کلی­باسیلوزیس در استان ایلام را جهت حضور ژن­های bla TEM و bla SHVمورد بررسی قرار دادند. ایشان نشان دادند که 10 جدایه (10%) واجد ژن bla TEM  و 2 جدایه (2%) واجد ژن bla SHV بود (قنبرپور و همتی، 1391). در مطالعه ما این ژن­های مقاومت شناسایی نشد. هو و همکاران طی مطالعه­ای در سوئد از میان 87 جدایه اشرشیا کلی به­دست آمده از طیور، 63% ژنوتیپ TEM بتالاکتاماز را نشان دادند (Ho‎ et al., 2008)، که با نتایج مطالعه حاضر مغایرت دارد. بنابراین، می­توان نتیجه گرفت که فراوانی ژن­های bla TEMو bla SHV در خارج از کشور بیشتر از داخل می­باشد. تفاوت در آمار نوع بیماری، تنوع تغذیه طیور، تفاوت در سن، ژنتیک طیور، تفاوت در سطح بهداشت و شرایط نگه­داری ماکیان و همچنین شرایط جغرافیایی و اقلیمی گوناگون کشورمان می­تواند از دلایل اختلاف سطح مقاومت و در نتیجه توزیع ژن­های مقاومتی باشد. در مطالعه شاهی و همکاران تعداد 15 سویه از 16 جدایه اشریشیا کلی به­دست آمده از زخم پای دیابتیک‌های دارای فنوتیپ ESBLs مثبت بودند و فراوانی ژن­های TEM-1 و  OXA-1 در 9 سویه و SHV-1 در 8 سویه مثبت بود (Shahi‎ ‎ et al., 2013). صرف­نظر از نتایج شیوع TEM و SHV، نتایج شیوع OXA در مطالعه ایشان با یافته­های مطالعه پیش­رو هم‌خوانی دارد. بـه­طورکلی، در این تحقیقات کمتر به یک خانواده بتالاکتامـازی توجه شده و اغلب، روی کـلاس­هـای محـدودی از هـر خانواده مطالعه صورت گرفته است. بنابراین، شناسایی سریع جدایه­های تولیدکننده ESBLs در آزمایشگاه­های میکروب­شناسی بسیار مهم و ضروری است. استفاده از MPCR باعث صرفه­جویی در مواد لازمPCR  می­شود. این روش دارای ویژگی و حساسیت بالا با کاهش زمان بررسی­های ژنتیکی و الگوهای مورد نیاز با چند جفت آغازگر به صورت عمومی و اختصاصی بوده و دارای قابلیت اعتماد و سرعت بالا در شناسایی ژن­ها می­باشد.

 

سپاسگزاری  

بدینوسیله نویسندگان مقاله بر خود لازم می­دانند تا از مدیریت و پرسنل محترم آزمایشگاه پاسارگاد تقدیر نمایند.

منابع

  • اسلامی، م. و نجار پیراهه، ش. (1391). شناسایی مولکولی و فنوتیپی بتالاکتامازهای TEM، PER و VEB در سویه­های بالینی اشریشیا کلی. مجله دانشگاه علوم پزشکی اراک، دوره 15، شماره 1، صفحات: 9-1.
  • امیری، پ.، پورنجف، ا.، شاولی پور، ا.، طیبی، ز.، گودرزی، ه. و اسلامی، گ. (1394). بررسی مقاومت آنتی­بیوتیکی ایزوله­های اشریشیا کلی تولید-کننده بتالاکتامازهای وسیع­الطیف (ESBLs) در بیماران مبتلا به عفونت­های ادراری.  مجله طب پیشگیری طبری، دوره 1، شماره 2، صفحات: 9-1.
  • بابایی کسمایی، ز.، امیرمظفری، ن.، فروهش تهرانی، ه.، آرش کیا، ا. و مهدوی، س. و بهرامی، س. (1391). تعیین حساسیت دارویی در اشریشیا کلی مقاوم به چند دارو در بیماران سرپایی با عفونت ادراری در تهران. مجله میکروب شناسی پزشکی ایران، دوره 6، شماره 9، صفحات: 44-37.
  • عبدالهی خیرآبادی، س.، نجفی پور، س.، کفیل زاده، ف.، عبدالهی، ع.، جعفریف، س. و مروج، ع. (1391). بررسی الگوی مقاومت دارویی در سویه های اشریشیا کلی جدا شده از بیماران مراجعه­کننده به بیمارستان ولی­عصر شهرستان فسا. مجله دانشگاه علوم پزشکی فسا، دوره 4، شماره 8، صفحات: 278-273.
  • قنبرپور، ر. و همتی، ز. (1391). شناسایی ژن­های بتالاکتامازها و الگوی مقاومت آنتی­بیوتیکی در سویه­های اشریشیا کلی جدا شده از کلی باسیلوز در گوشت ماکیان در استان ایلام. مجله تحقیقات آزمایشگاهی دامپزشکی، دوره 4، شماره 1، صفحه: 90.
  • مسجدیان جزی، ف.، طالبی، م. و رستگار لاری، ا. (1386). ارزیابی مولکولی مقاومت به آنتی بیوتیک­های وسیع­الطیف در اشریشیا کلی و کلبسیلا پنومونیه. مجله میکروب شناسی پزشکی ایران، دوره 1، شماره 2، صفحات: 34-27.
  • مهاجری، پ.، ایزدی، ب.، رضایی، م.، فلاح، ب.، خادمی، ه. و ابراهیمی، ر. (1390). ارزیابی فراوانی اشریشیا کلی تولیدکننده بتالاکتامازهای وسیع­الطیف جدا شده از عفونت­های ادراری و تعیین الگوی مقاومتی آنها در کرمانشاه. مجله دانشگاه علوم پزشکی اردبیل، دوره 11، شماره 1، صفحات: 94-86.
    • Al-Jasser, A.M. (2006). Extended-Spectrum Beta-Lactamases (ESBLs): A global problem. Kuwait Medical Journal, 38(3):171-185.
    • Al-Tawfiq, J.A. (2006). Increasing antibiotic resistance among isolates of Escherichia coli recovered from inpatients and outpatients in a Saudi Arabian hospital. Infection Control and Hospital Epidemiology, 27(7): 748-753.
    • Baig, M.H., Sudhakar, D.R., Kalaiarasan, P., Subbarao, N., Wadhawa, G., Lohani, M., et al. (2014). Insight into the Effect of Inhibitor Resistant S130G Mutant on Physico-Chemical Properties of SHV Type Beta- Lactamase: A Molecular Dynamics Study. PLoS One, 9(12): 1-19.
    • Bradford, P.A. (2001). Extended-Spectrum β-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clinical Microbiology Reviews, 14(4): 933-951.
    • Caudry, S.D. and Stanisich, V.A. (1979). Incidence of antibiotic resistant Escherichia coli associated with frozen chicken carcasses and characterization of conjugative R-plasmids derived from such strains. Antimicrobial Agents and Chemotherapy, 16: 701-709.
    • Cockerill, F. (2011). Performance Standards for Antimicrobial Susceptibility Testing: Twenty-first Informational Supplement. Clinical and Laboratory Standards Institute, 31(1): 42-46.
    • Duttaroy, B. and Mehta, S. (2005). Extended spectrum beta-lactamases (ESBL) in clinical isolates of Klebsiella pneumoniae and Escherichia coli. Indian Journal of Pathology and Microbiology, 48(1): 45-48.
    • Haider, M.G., Hossain, M.G., Hossain, M.S., Chowdhury, E.H., Das, P.M. and Hossain, M.M. (2004). Isolation and characterization of Enterobacteria associated with health and disease in sonali chickens. Bangladesh Journal of Veterinary Medicine, 2: 15-21.
    • Ho, P.L., Chun-Wai Wong, R., Chow, K.H., Yip, K., Sai-Yin Wong, S. and Que T.L. (2008). CTX-M type beta-lactamases among fecal Escherichia coli and Klebsiella pneumoniae isolates in non-hospitalized children and adults. Journal of Microbiology, Immunology and Infection, 41(5): 428-432.
    • Linton, A.H., Howe, K., Hartley, C.L., Clements, H.M., Richmond, M.H. and Osborne, A.D. (1977). Antibiotic resistance among Escherichia coli O-serotypes from the gut and carcasses of commercially slaughtered broiler chickens: a potential public health hazard. Journal of Applied Bacteriology, 42: 365-378.
    • Lutful Kabir, S.M. (2010). Avian Colibacillosis and Salmonellosis: A Closer Look at Epidemiology, Pathogenesis, Diagnosis, Control and Public Health Concerns. International journal of environmental. Research and Public Health, 7(1): 89-114. 
    • Maynard, C., Fairbrother, J.M., Bekal, S., Sanschagrin, F., Levesque, R.C., Brousseau, R., et al. (2003). Antimicrobial Resistance Genes in Enterotoxigenic Escherichia coli O149:K91 Isolates Obtained over a 23-Year Period from Pigs. Antimicrobial Agents and Chemotherapy, 47(10): 3214-3221.
    • Pitton, J.S. (1972). Mechanism of bacterial resistance to antibiotics. Review of Physiology, 65: 15-93.
    • Rawat, D. and Nair, D. (2010).Extended-spectrum β-lactamases in Gram Negative Bacteria. Journal of Global Infectious Disease, 2(3): 263-274.
    • Schwaber, M.J., Navon-Venezia, S., Schwartz, D. and Carmeli, Y. (2005). High levels of antimicrobial coresistance among extended-spectrum-beta-lactamase-producing Enterobacteriaceae. Antimicrobial Agents Chemotherapy, 49: 2137-2139.
    • Shahi, S.K., Singh, V.K. and Kumar, A. (2013). Detection of Escherichia coli and associated β-lactamases genes from diabetic foot ulcers by multiplex PCR and molecular modeling and docking of SHV-1, TEM-1, and OXA-1 β-lactamases with clindamycin and piperacillin-tazobactam. PLoS One, 8(7): e68234.
    • Turtura, G.C., Massa, S. and Chazvinizadeh, H. (1990). Antibiotic resistance among coliform bacteria isolated from carcasses of commercially slaughtered chickens. International Journal of Food Microbiology,11: 351-354.