مقایسه واکنش زنجیره‌ای پلی‌مراز (PCR) و الیزای تجاری به‌منظور شناسایی عفونت با ویروس لکوز در گاوهای شیری

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانشیار گروه علوم درمانگاهی، دانشکده دامپزشکی، دانشگاه تبریز، تبریز، ایران.

2 استاد گروه علوم دامی، دانشکده کشاورزی، دانشگاه تبریز، تبریز، ایران.

3 دانش‌آموخته دامپزشکی، شرکت سوا، تهران، ایران.

چکیده

   ویروس لوسمی گاوی (BLV) یک رتروویروس است که باعث لکوز انزوتیک گاوی می­شود. روش متداول برای شناسایی وجود عفونت با BLV غربالگری آنتی­بادی­ها است. آگار ژل ایمونودیفیوژن و الیزا به­طور گسترده­ای برای شناسایی آنتی­بادی­های ضد BLV استفاده می­شود. تکثیر و شناسایی  DNA پروویروس لکوز گاو به­وسیله واکنش زنجیره­ای پلی­مراز (PCR) روش توانمندی است که قادر به تشخیص مستقیم عفونت می­باشد. با این حال، استفاده گسترده از این روش به منظور تشخیص آزمایشگاهی بیماری محدودیت‌هایی داشته و  نیاز به مطالعات بیشتری دارد. هدف از این مطالعهمقایسه نتایج آزمون واکنش زنجیره­ای پلی­مراز و یک الیزای تجاری در شناسایی پروویروس لکوز گاو و آنتی­بادی­های ضد این ویروس در خون گاو­های شیری بود. بدین منظور حساسیت و ویژگی نسبی واکنش زنجیره­ای پلی­مراز در مقایسه با یک الیزای تجاری مورد ارزیابی قرار گرفت. نمونه­های خونی از 173 رأس گاو شیری از گاوداری­های اطراف تبریز تهیه شد و توسط یک الیزای تجاری به منظور تشخیص آنتی­بادی ضد لکوز ویروس گاو و نیز توسط واکنش زنجیره‌ای پلی‌مراز  مورد ارزیابی قرار گرفتند. حساسیت و ویژگی نسبی آزمون واکنش زنجیره­ای پلی­مراز در مقایسه با الیزای تجاری به ترتیب 100% و 6/98% محاسبه شد. فراوانی حضور بخش هدف از ژن gag در واکنش زنجیره­ای پلی­مراز 3/13% و فراوانی پاسخ سرمی مثبت با الیزای تجاری 1/12% به­دست آمد. نتایج حاکی از آن است که امکان استفاده از واکنش زنجیره­ای پلی­مراز در تشخیص آزمایشگاهی بیماری وجود دارد.

کلیدواژه‌ها


عنوان مقاله [English]

A comparative study for diagnosis of Bovine Leukemia Virus (BLV) infection in dairy cows by Polymerase Chain Reaction (PCR) and Enzyme Linked Immunosorbent assay (ELISA)

نویسندگان [English]

  • raziallah jafari jozani 1
  • gholamali moghaddam 2
  • mohsen asmand 3
چکیده [English]

Bovine Leukemia Virus (BLV) is a retrovirus that causes bovine enzootic leukemia (EBL). The routine method for the diagnosis of the infection is antibody screening tests. Agar gel immunodiffusion (AGID) and ELISA are widely used for detection of the antibody against BLV. Amplification and detection of the proviral DNA by PCR is a powerful method for direct detection of the infection. However there are some limitations for routine use of this method in laboratory diagnosis of the disease and it requires further investigations. The objective of this study was to compare the results of a PCR assay with a commercial ELISA in detection of the bovine leukemia provirus and antibodies to this agent, in blood samples of dairy cows. The ELISA was assumed as reference test and the relative sensitivity and specificity of the PCR assay was calculated by testing samples from 173 cows in suburb of Tabriz. Blood sample were taken and taken sera and DNA contents were harvested. Sensitivity and specificity of the PCR assay in caparison to commercial ELISA were 100% and 98.6% respectively. The frequency of the presence of the targeted part of gag gene in PCR was 13.3% and the frequency of the seropositive reaction by commercial ELISA was 12.1%. The results showed that it is possible to use PCR as a laboratory diagnostic method for identification of the disease.

کلیدواژه‌ها [English]

  • Bovine Leukosis
  • Polymerase Chain Reaction (PCR)
  • Commercial Enzyme Linked Immunosorbent assay (ELISA)

مقدمه

   ویروس لوسمی گاوی (BLV) یک رتروویروس اگزوژنی بوده که باعث لکوز انزوتیک گاوی می­شود. در شرایط طبیعی این بیماری در گاو رخ می دهد اما گوسفند نیز به عفونت آزمایشگاهی حساس است. ویروس عمدتاً لنفوسیت‌های B را آلوده می­کند ولی همچنین در لنفوسیت‌های T، مونوسیت‌ها و گرانولوسیت­ها نیز یافت می­شود (Fechner et al., 1996; Poon et al., 1993). عفونت ایجادشده توسط BLV می­تواند منجر به سه وضعیت متفاوت شود: بروز عفونت و تولید پادتن، بروز عفونت و تولید پادتن به­علاوه رخداد لنفوسیتوز پایدار و بروز عفونت پایدار و تولید پادتن به‌علاوه لنفوسارکوم (Jafari Jozani et al., 2010). اولین وسیله برای شناسایی وجود عفونت BLV غربالگری آنتی­بادی­ها است. آگار ژل ایمونودیفیوژن و الایزا به­طور گسترده­ای برای شناسایی آنتی­بادی­های BLV استفاده می­شود (Johnson and Kaneene, 1991). با این وجود، روش­های مذکور در شناسایی گاوهای مبتلا به BLVکه فاقد آنتی­بادی بوده و یا تیتر آنتی­بادی آنها ناچیز است، مفید و کارآمد نخواهد بود (Brandon et al., 1991). از این­رو، مهم است که وجود عفونت را با تشخیص مستقیم ویروس تعیین نمود. تکثیر و شناسایی DNA پروویروسی BLV و سکانس­های RNA آن به‌وسیله واکنش زنجیره­ای پلیمراز (PCR) نشان داده شده است که یک روش مناسب در تشخیص مستقیم عفونت BLV می‌باشد (Kittelberger et al., 1996; Poon et al., 1993).

   هدف از این مطالعه مقایسه نتایج آزمون واکنش زنجیره­ای پلی­مراز و یک الیزای تجاری در شناسایی پروویروس لکوز گاو و آنتی‌بادی‌های ضد این ویروس در خون گاو­های شیری می­باشد که بدین منظور حساسیت و ویژگی نسبی واکنش زنجیره‌ای پلی­مراز در مقایسه با یک الیزای تجاری مورد ارزیابی قرار گرفته است.

 

مواد و روش­ها

نمونه‌های سرمی

   نمونه‌های خونی از 173 رأس گاو  شیری هلشتاین و از گاوداری­های اطراف تبریز تهیه شدند،  تمامی حیوانات در بازه سنی 2 تا 5 سال قرار داشتند و در  معاینه بالینی به ظاهر سالم بودند. نمونه های خونی پس از اخذ در شرایط مناسب به آزمایشگاه انتقال یافتند. جهت استخراج سرم، نمونه­های خون درg 1000 به‌مدت 10 دقیقه سانتریفوژ شده و سرم­ها جدا گردیدند. تمامی نمونه­های سرمی در میکروتیوپ ریخته شده و تا زمان انجام آزمایش در دمای 20- درجه سلسیوس نگه‌داری شدند.

   الیزای غیر مستقیم تجاری جهت تشخیص آنتی‌بادی ضدویروس لکوز گاو تمامی نمونه‌های سرمی اخذ شده با کیت تجاری (IDEXX, USA) طبق دستورالعمل شرکت سازنده جهت  تشخیص آنتی‌بادی‌های ضد ویروس لکوز گاو مورد آزمایش قرار گرفتند.

الیزای تجاری

   نمونه‌های سرمی استحصال شده به‌منظور تشخیص آنتی‌بادی ضد لکوز ویروس گاو، توسط کیت تجاری (IDEXX,US) مورد ارزیابی قرار گرفتند. به این منظور از دستگاه الیزا ریدر (DANA 3200, IRAN) در طول موج nm 450 بهره گرفته شد.

استخراج DNA

   پس از جداسازی لوکوسیت‌ها از نمونه‌های خونی توسط گرادیانت فایکول و سه مرتبه شستشوی آن‌ها با فسفات بافر سالین (4/7pH=)، سلول­ها در µl 465 بافر لیزکننده (حاوی 100 میلی­مولار کلرید سدیم، 25 میلی‌مولار EDTA و 10 میلی­مولار تریس-کلریدریک با pH=7.0 و نیم درصد سدیم دودسیل سولفات) و پروتئیناز K (mg/ml 1) تخریب شدند، سپس مطابق توصیه سازنده کیت (Bioneer, S. Korea) و با استفاده از ستون­های سیلیکا ژل استخراج DNA انجام شد. سپس DNA خشک شده در μl200-100 از بافر TE (Tris-EDTA) تا رسیدن به تغلیظ μg/μl 5/0 حل شد.

   کنترل مثبت شامل DNA استخراجی از سلول­های رده FLK-BLV بود (هدیه از طرف دکتر فرهید همت‌زاده، دانشگاه آدلاید، استرالیا).

   این سلول­ها توسط پروتئیناز K و بافر لیزکننده هضم شدند، سپس مطابق توصیه سازنده کیت (Bioneer, S. Korea) و با استفاده از ستون­های سیلیکا ژل استخراج DNA انجام شد.

ارزیابی کمی و کیفی به ترتیب توسط روش اسپکتروفتومتری و با استفاده از دستگاه بایوفتومتر(Eppendorof, Germany) در طول موجnm 260 و nm280 و الکتروفورز ژل آگاروز همراه با رنگ‌آمیزی توسط اتیدیوم بروماید انجام گردید.

پرایمرها

از دو پرایمر

 gag4 (5 GGTTCCTTAGGACTCCGTCG 3) و

 gag3 (5 AACACTACGACTTCGAATCG 3) برگرفته از قطعات ژنومیBLV، برای PCR استفاده گردید (Fechner et al., 1996). علت انتخاب ژن gag به دلیل حفاظت و مصونیت ناحیه مربوطۀ آن می‌باشد.

واکنش زنجیره‌ای پلی­مراز

   تمام واکنش‌های  PCRدرحجم µl20 از محلول حاوی µl1 نمونه  ng DNA100،  µl4/0 از  mM 2/0dNTPs mix ، µl 4/1 از  mM MgSo45/3، µl2 از بافر PCR،  µl12/0 از 6/0 واحد پلی­مراز platinum Taq و  µl4/0 از 2/0 mM از هر پرایمر صورت گرفت.

   واکنش زنجیره‌ای پلی­مراز در دستگاه ترمال سایکلر پریموس  96 (MWG, Germany)، با چرخش حرارتی به صورت دناتوراسیون اولیه برای 5 دقیقه در ˚C95، سپس 35 چرخش در ˚C94 برای 1 دقیقه، ˚C65 به مدت 1 دقیقه و  ˚C72 برای 2 دقیقه و در نهایت کامل‌سازی قطعات به مدت 10 دقیقه در ˚C72 انجام گرفت (Fechner et al., 1996).

   برای رویت و عکس­برداری از محصول تکثیر یافته در PCR از الکتروفورز ژل آگارز (2%) در بافر تریس استات EDTA و نیز رنگ­آمیزی با اتیدیوم بروماید (mg/ml 5) استفاده شد. در نمونه فاقد الگو (non template control) از آب مقطر دو بار تقطیر استفاده شد. به عنوان کنترل مثبت نیز از DNA استخراج شده از رده سلولی FLK-BLV (هدیه از طرف دکتر فرهید همت­زاده، دانشگاه آدلاید، استرالیا) در واکنش زنجیره­ای پلی­مراز فوق استفاده شد.

کنترل واکنش

از دو پرایمر

 PRL033 (5- CGAGTCCTTATGAGCTTGATTCTT -3)

 وPRL035  (5- GCCTTCCAGAAGTCGTTTGTTTTC -3) به‌منظور تکثیر بخش اگزوژن شماره 3 ژن پرولاکتین گاوی استفاده شد.

 

 

تحلیل آماری داده­ها

   حساسیت و ویژگی نسبی آزمایش واکنش زنجیره­ای پلی­مراز در مقایسه با الیزای تجاری، مطابق فرمول‌های زیر محاسبه شد:

 

 

 

 

 

 

 

 

   نتایج آزمایش واکنش زنجیره­ای پلی­مراز و الیزای تجاری توسط آزمون بررسی توافق مثبت (آماره کاپا) و در نرم­افزار SPSS ویرایش 16 مورد مقایسه قرار گرفت و تفسیر آماره کاپا به صورت زیر انجام گردید:

   آماره کاپا بین صفر (شانس) و یک ( توافق کامل) متغییر می­باشد. تفسیر آن طبق نظری است که توسط لاندیس و کچ در سال 1977 ارائه شده است. بدین صورت­که مقادیر بین صفر و دو دهم معادل توافق جزئی، بین 21/0 و 4/0 معادل توافق اندک، بین 41/0 و 6/0 معادل توافق متوسط، بین 61/0 و 7/0 معادل توافق محکم و بین 71/0 تا یک معادل توافق بسیار کامل می باشد (Landis and Koch, 1977).

 

یافته­ها

   الیزای تجاری قادر به شناسایی آنتی‌بادی ضد ویروس لکوز گاو در 21 مورد از  نمونه های سرمی آزمایش شده بود.

   در روش واکنش زنجیره‌ای بر مبنای مشاهده محصول واکنش زنجیره­ای پلی­مراز (با وزن تقریبی 370 جفت باز) تعداد 23 مورد از نمونه­های تحت مطالعه دارای واکنش مثبت بودند (شکل 1).

 

 

 

 

 

 

 

 

 

 

 

 

شکل 1- الکتروفورز ژل آگاروز رنگ­آمیزی شده با اتیدیوم بروماید؛ خط یک نردبان وزن مولکولی، خطوط دو تا پنج: بخش هدف از ژن پرولاکتین، خط شش: نمونه شاهد فاقد الگو، خط هفت: بخش هدف از ژن gag (پروویروس لکوز گاو)، خط یازده: نمونه با واکنش پلی مراز زنجیره ای منفی.

 

  

 

   در کلیه نمونه­هایی که مورد استخراج DNA قرارگرفته بودند، بخش هدف از ژن پرولاکتین مورد تکثیر قرار گرفت و یک باند با وزن تقریبی 156 جفت باز مشاهده شد (شکل 1).

حساسیت و ویژگی نسبی آزمون واکنش زنجیره­ای پلی‌ مراز در مقایسه با الیزای تجاری به ترتیب 100% و 6/98% محاسبه شد. فراوانی حضور بخش هدف از ژن gag در واکنش زنجیره­ای پلی­مراز 3/13% و فراوانی پاسخ سرمی مثبت با الیزای تجاری 1/12% محاسبه شد. نتایج مثبت و منفی هر دو واکنش زنجیره­ای پلی­مراز و الیزای تجاری در جدول 1 با یکدیگر مقایسه شده است. توافق بین دو آزمایش بر حسب آماره کاپا، 94/0 محاسبه شد که نشان از توافق محکم میان واکنش زنجیره­ای پلی­مراز و الیزای تجاری وجود دارد.

 

 

 

جدول 1- نتایج واکنش زنجیره‌ای پلی­مراز و الیزای تجاری در تشخیص موارد مثبت و منفی در سرم گاوها

 

نمونه‌های سرمی دام‌ها

جمع

الیزای تجاری (مثبت)

الیزای تجاری (منفی)

واکنش زنجیره‌ای پلی­مراز (مثبت)

21

2

23

واکنش زنجیره‌ای پلی مراز (منفی)

0

150

150

جمع

21

152

173

 

 

 

 

 بحث و نتیجه‌گیری

   برای تشخیص آزمایشگاهی عفونت ناشی از ویروس لکوز گاو روش­های مختلفی وجود دارد که عمده آنها بر اساس پدیده اتصال آنتی­ژن به آنتی­بادی عمل می‌کنند. از این میان می­توان به AGID، ELISA وWestern blotting  اشاره نمود (Kittelberger et al., 1996; Simard et al., 2000).

   گرچه این روش­ها تا حدودی ارزان قیمت بوده و انجام آنها آسان می­باشد، اما برخی از محققین معتقد هستند که این آزمایشات به اندازه کافی برای شناسایی این عفونت حساس نیستند (Burkhardt et al., 1993; Jacobs et al., 1992)، به­ویژه زمانی­که  بدانیم این آزمایشات قادر به تفکیک ایمنی مادری از عفونت فعال نبوده و حتی بلافاصله بعد از رخداد عفونت فعال قادر به شناسایی آنتی بادی­ها نیستند.

   در مقابل آزمایشات مذکور که به شکل غیرمستقیم به تشخیص آزمایشگاهی عفونت می­پردازند، روش­های مولکولی وجود دارند که به شکل مستقیم در جستجوی ژنوم پروویروس در نمونه می­باشند. در میان این روش­ها واکنش زنجیره­ای پلی­مراز (PCR) به شکل روزافزونی در تشخیص آزمایشگاهی این عفونت گسترش یافته است (Poon et al., 1993; Sherman et al., 1992; Tani et al., 1997).   

   در مطالعات تجربی مشاهده شده است که PCR هفت روز بعد از ایجاد عفونت قادر به تشخیص ویروس می­باشد درحالی که آزمایشات سرولوژیک سه هفته بعد از این زمان قادر به شناسایی آنتی­بادی­ها هستند (Brandon et al., 1991; Klintevall et al., 1994).

   حساسیت بالای PCR موجب شده که از آن در تجارت حیوانات و در مراکز تلقیح مصنوعی و اصلاح نژاد برای شناسایی عوامل عفونی استفاده شود. گذشته از این، می­توان از این آزمایش در برنامه­های ملی مبارزه با بیماری لکوز گاو به­خصوص زمانی­که بر اثر راهکارهای قبلی فراوانی بیماری کاهش یافته است، به منظور تایید صحت آزمایشات سرولوژیک متداول استفاده نمود. یکی از مشکلات آزمایشات سرولوژیک به­ویژه انواع الیزا، نتایج مشکوک آنها می­باشد که در این موارد می­توان با استفاده از روش واکنش زنجیره­ای پلی‌مراز به تایید یا رد این دسته از نتایج اقدام نمود. نتایج آزمایش الیزا در این مطالعه حاکی از فراوانی نسبی1/12% می­باشد که با نتایج مطالعه قبلی جعفری جوزانی و همکاران در سال 2010 هماهنگ می­باشد (Jafari Jozani et al., 2010). این نتایج در مقایسه با نتایج گزارش­های حدادزاده در سال 1364، کارگر موخر و همکاران در سال 1375 و ممتاز و همت­زاده در سال 1374 حاکی از گسترش بیماری در طی سه دهه اخیر می باشد (حدادزاده، 1364؛ کارگر موخر و همکاران، 1375؛ ممتاز و همت­زاده، 1374).

   مسئله‌ای که باید به آن توجه نمود این است که فراوانی نسبی این عفونت در کشور دامنه وسیعی دارد و از 5/0% (حاجی حاجیکلایی  و همکاران، 1375)، تا 30% (کارگر موخر و همکاران 1375) متغیر است. بر این اساس می توان انتظار داشت که استفاده از یک روش منحصر به فرد برای تشخیص آزمایشگاهی عفونت راه حل مناسبی نمی­باشد و با توجه به جمیع شرایط باید از روش مناسبی برای تشخیص آزمایشگاهی استفاده نمود. نتایج این مطالعه نشان می­دهد که می­توان از هر دو آزمایش الیزا و PCR برای تشخیص عفونت استفاده نمود. برخی از مطالعات قبلی حاکی از حساسیت بالاتر آزمایش PCR در مقایسه با الیزا هستند. به‌طور مثال فچنر و همکاران در سال 1996 با آزمایش PCR، 10% فراوانی نسبی بالاتری را در مقایسه با الیزا مشاهده نمودند که البته گاو­های مورد مطالعه توسط ایشان دارای فراوانی بسیار پایینی از نقطه نظر این بیماری بودند. در این مطالعه آزمایش PCR قادر به شناسایی تمامی موارد مثبت شناسایی شده توسط آزمون الیزا تجاری بود (حساسیت 100%) ضمن اینکه، دو مورد از نتایج منفی الیزای تجاری نیز مثبت تشخیص داده شد (Fechner et al., 1996).

   در هر صورت باید توجه داشت که فراوانی بیماری یکی از عوامل تعیین­کننده نوع آزمایش مورد استفاده در تشخیص آزمایشگاهی این عفونت می­باشد. به­طور مثال، در مناطقی که فراوانی عفونت به ویروس لکوز گاو بالاتر می­باشد، استفاده از آزمایشی با ویژگی بالا دارای اهمیت بیشتری است و در مقابل، در مناطقی که فراوانی بیماری پایین است استفاده از روشی با حساسیت بالاتر، ارزشمند­تر می­باشد تا مطمئن شویم مواردی که منفی در نظر گرفته شده­اند، واقعاً منفی می­باشند گرچه ممکن است که در این روند شاهد رخداد موارد مثبت کاذب باشیم.

   علی‌رغم این­که در دهه گذشته پیچیدگی انجام آزمایش و هزینه گزاف آن از جمله عوامل ممانعت­کننده از توسعه PCR به منظور تشخیص بالینی بوده است، اما در طی چند سال گذشته با پیشرفت­های چشمگیر در این زمینه هزینه انجام این آزمایش و مشکلات انجام آن به شدت کاهش یافته است و همین امر زمینه را برای استفاده روزمره آن به منظور شناسایی پروویروس در خون گاو­ها فراهم می‌سازد.

 

سپاسگزاری

   نگارندگان بر خود لازم می‌دانند از معاونت محترم پژوهشی و فناوری و کارکنان محترم مدیریت پژوهشی و فناوری دانشگاه تبریز به‌خاطر فراهم نمودن امکانات مالی برای انجام این مطالعه و نیز از جناب دکتر ذکریا زاده (کارشناس  سازمان دامپزشکی استان آذربایجان‌شرقی) تشکر و قدردانی نمایند.

  • حاجی حاجیکلایی، م.ر.، صیفی آباد شاپوری، م.ر. و اکبری م. (1375). مطالعه سرولوژیکی آلودگی به ویروس لکوز گاوی (BLV) در گاوهای اهواز. پژوهش و سازندگی، شماره 71، صفحات: 30-26.
  • حدادزاده، ح.ر. (1364). فراوانی آلودگی با ویروس لکوز انزئوتیک گاوها در گاوداری های اطراف تهران، پایان نامه برای دریافت دکتری دامپزشکی از دانشگاه تهران، شماره 1577.
  • کارگر موخر، ر.، اهورایی، پ.، قابوسی، ب.، خدمتی. ک.، عزی، ع.، پورزاهدی، ر. و همکاران (1375). بررسی سرواپیدمیولوژیک بیماری لکوز آنزوتیک گاوان (EBL) در ایران، پژوهش و سازندگی، شماره 30، صفحات: 166-164.
  • ممتاز، ح. و همت زاده، ف. (1374). بررسی سرولوژیک آلودگی به ویروس لکوز گاو ها (BLV) در گاوداری­های استان چهارمحال و بختیاری. مجله تحقیقات دامپزشکی ایران، دوره 4، شماره1، صفحات: 44-37.
    • Brandon, R., Naif, H., Daniel, R.C.W. and Lavin, M.F. (1991). Early detection of bovine leucosis DNA in infected sheep using the polymerase chain reaction. Research in Veterinary Sciences, 50: 79-94.
    • Burkhardt, H., Fechner, H., Mewes, G., Mewes, L., Wagner, H. and Ebner, D. (1993). Search with capture-ELISA nucleic acid probe and DNA-ampli®cation for BLV in a AGID seronegative dairy cattle herd in a long term study. In: 22nd FEBS Meeting, Stockholm, Sweden.
    • Eaves F.W., Molloy, J., Dimmock, C. and Eaves, L. (1994). A field evaluation of the polymerase chain reaction procedure for the detection of bovine leukaemia virus proviral DNA in cattle. Veterinary Microbiology, 39: 313-321.
    • Fechner, H., Kurg, A., Geue, L., Blankenstein, P., Mewes, G., Ebner, D., et al. (1996). Evaluation of polymerase chain reaction (PCR) application in diagnosis of bovine leukaemia virus (BLV) infection in naturally infected cattle. Zentralbl Veterinarmed, 43(10): 621-30.
    • Heeney, J., Valli, P., Jacobs, R. and Valli, V. (1992). Evidence for bovine leukemia virus infection of peripheral blood monocytes and limited antigen expression in bovine lymphoid tissue. Laboratory Investigations, 66: 607-617.
    • Jacobs, R.M., Smith, H.E., Gregory, B., Valli, V.E. and Whetstone, C.A. (1992). Detection of multiple retroviral infections in cattle and cross-reactivity of bovine immunode®ciency-like and human immunode®ciency virus type 1 proteins using bovine and human sera in a Western blot assay. Canadian Journal of Veterinary Research, 56: 353-359.
    • Jafari Jozani, R., Moghaddam, Gh., Khazraiinia, P. and Jabbari Nooghabi, H. (2010). Adaptation of an indirect enzyme-linked immunosorbent assay by purified gp51SU for detection of antibodies to bovine leukemia virus. Iranian Journal of Veterinary Research, 11 (4): 332-336.
    • Johnson, R. and Kaneene, J.B. (1991). Bovine leukemia virus. Part 1.Descriptive epidemiology, clinical manifestations and diagnostic tests. Compensation Continuing Education 13: 315-325.
    • Johnson, R. and Kaneene, J.B. (1992). Bovine leukaemia virus and enzootic bovine leukosis. Veterinary Bulletin, 62: 276-312.
    • Kittelberger, R., Laybourn, B.J., Diack, D.S., Penrose, M.E., Reichel, M.P., Motha, J., et al. (1996). Evaluation of electrophoretic immunoblotting for the detection of antibodies against the bovine leukosis virus in cattle. Journal of Virological Methods, 61: 7-22.
    • Klintevall, K., Ballagi-Pordany, A., Naslund, K. and Belak, S. (1994). Bovine leukemia virus: rapid detection of roviral DNA by nested PCR in blood and organs of experimentally infected calves. Veterinary Microbiology, 42: 191-204.
    • Landis, J.R. and Koch, G.G.) 1977(. The measurement of observer agreement for categorical data. Biometrics, 33: 159-174.
    • Poon, H., Jimenez, E., Jacobs, R.M., Song, Z. and Jefferson, B. (1993). Detection of bovine leukemia virus RNA in serum using the polymerase chain reaction. Journal of Virological Methods, 41: 101-112.
    • Schwartz, I., Bensaid, A., Polack, B., Perrin, B., Berthelemy, M. and Levy, D. (1994). In vivo leukocyte tropism of bovine leukemia virus in sheep and cattle. Journal of Virology, 67: 4579-4596.
    • Sherman, M., Ehrlich, G., Ferrer, J., Sninsky, J., Zandomeni, R., Dock, N. and Poiesz, B. (1992). Amplification and analysis of specific DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction. Journal of Clinical Microbiology, 30: 175-191.
    • Sherman, M.P., Ehrlich, G.D., Ferrer, J.F., Sninsky, J.J., Zandomeni, R., Dock, N.L., et al. (1992). Ampli®cation and analysis of speci®c DNA and RNA sequences of bovine leukemia virus from infected cows by polymerase chain reaction. Journal of Clinical Microbiology, 30: 175-191.
    • Simard, C., Richardson, S., Dixon, P., Bélanger, C. and Maxwell, P. (2000). Enzyme-linked immunosorbent assay for the diagnosis of bovine leukosis: comparison with the agar gel immunodiffusion test approved by the Canadian Food Inspection Agency. Canadian Journal Veterinary Research, 64(2): 101-106.
    • Tani, K., Asahina, M., Wu, D.L., Ajito, T., Murakami, K., Goryo, M., et al. (1997). Further analysis of the phenotype and distribution of tumor cells in sporadic B-cell and T-cell lymphomas in the lymph node and spleen of cattle. Veterinary Immunology and Immunopathology, 55: 273-290.