مطالعه شیوع سرمی لیشمانیوز احشائی در سگ‌سانان وحشی منطقه سراب (استان آذربایجان شرقی) در سال 89-88

نوع مقاله: علمی پژوهشی

نویسندگان

1 گروه علوم آزمایشگاهی، دانشگاه آزاد اسلامی، واحد مرند، ،مرند، ایران

2 گروه انگل شناسی، دانشکده پزشکی، دانشگاه علوم پزشکی تبریز، تبریز، ایران

3 گروه انگل شناسی، دانشکده دامپزشکی، دانشگاه تهران، تهران، ایران

4 گروه پاتولوژی، دانشکده علوم تخصصی دامپزشکی، دانشگاه آزاد اسلامی، واحدعلوم و تحقیقات تهران، تهران، ایران

چکیده

این تحقیق جهت بررسی سرمی شیوع لیشمانیوز احشائی زئونوتیک (ZVL) در میان سگ­سانان اطراف شهرستان سراب و بررسی احتمال وجود ارتباط بین سگ­سانان آلوده در انتقال انگل به انسان در سال 89-88 انجام گردید. در این مطالعه جمعاً 10 نمونه سرم روباه و 2 نمونه سرم گرگ تهیه شد و نمونه­ها در آزمایشگاه تک­یاخته شناسی دانشکده بهداشت و تغذیه دانشگاه علوم پزشکی تبریز با استفاده از تست­های سرولوژیکی Elisa و IFAمورد آزمایش قرار گرفتند. در نتیجه این بررسی، 1 روباه از 10 روباه شکار شده با تست­های IFA و ELISA  به صورت سرم مثبت گزارش گردید. میزان تیتر IFA بزرگتر یا مساوی 1:1280 و میزان جذب نوری در ELISA برابر با 127/2 (138%= درصد نمونه(S/P%)) بود، روباه مذکور دارای علایم مشخص بیماری شامل ضایعات جلدی، ریزش مو، لاغری، بزرگی و پیچیدگی ناخن­ها، هپاتواسپلینومگالی بود. در لام­های گسترش تماسی تهیه شده از کبد و طحال این روباه، جسم لیشمن مشاهده و نتیجه کشت هم مثبت بود. در این مطالعه از 2 گرگ شکار شده هیچ کدام به صورت سرم مثبت گزارش نگردید و نتایج کشت هم منفی بود. انگل­های ایزوله شده از روباه سرم مثبت با استفاده از پرایمرهای اختصصاصی k-DNA  آزمایش PCR شد و نمونه مربوط به انگل جدا شده از روباه آلوده به طور اختصاصی دارای 99% همولوژی  با complex  Donovani (L.infantum ,L.donovani, L.Chagasi) بود.

کلیدواژه‌ها


عنوان مقاله [English]

Seroprevalence survey on wild canine visceral Leishmaniasis in Sarab District (East Azerbaijan Province) Northwest of Iran during 2009-2010

نویسندگان [English]

  • M Khanmohammadi 1
  • E Fallah 2
  • S Rahbari 3
  • S Hesaraki 4
1 Department of Laboratory Sciences, Marand Branch, Islamic Azad University, Marand, Iran
2 Department of Parasitology, Tabriz University of Medical Sciences, Tabriz, Iran
3 Department of Parasitology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
4 Department of Pathology, Faculty of Veterinary Medicine, Science and Research Branch, Islamic Azad University, Tehran, Iran
چکیده [English]

This study was done to determine the prevalence of Zoonotic visceral leishmaniasis (ZVL) in wild canines around the city of Sarab and the possible association between infection in wild canines and people during 2009-2010. In this study 10 serum samples from foxes (Vulpes vulpes) and two serum samples from wolves (Canis lupus) were prepared. Samples were examined in the parasitology laboratory of Tabriz Medical University using Elisa and IFA serological tests. Only one fox of 10 with IFA and ELISA tests was seropositive. The IFA titre was greater than or equal to 1:1280 and amount of light absorption in ELISA equal to 2.127  and percent of samples (S/P%)=138%. The fox had specific symptoms of disease including cutaneous ulcers, hair loss, Impotence, Onicocriptosis, local or general lymphadenopathy, Keratitis and Hepatosplenomegaly. In slides prepared from impression smear of liver and spleen Leishman body was observed and culture results were positive. In this study the two wolves were not seropositive and the result of culture was negative. Parasites isolated from seropositive fox were tested with specific primers of k-DNA using PCR and indicated 99% homology with complex Donovani (L.infantum, L.donovani, L. Chagasi).

کلیدواژه‌ها [English]

  • Visceral Leishemanisis
  • Elisa
  • IFAT
  • Fox
  • Sarab

      سازمان بهداشت جهانی WHO عفونت ناشی از L.infantum را به­عنوان یکی از 6 بیماری عفونی مهم انسان در دنیا اعلام نموده است. اگرچه در سال­های اخیر میزان توجه به لیشمانیوز به عنوان یک مشکل بهداشت عمومی افزایش یافته، ولی اقدامات موجود برای کنترل این بیماری هنوز کافی به نظر نمی­رسند. تنوع زیادی که در اشکال بالینی و موقعیت­های اپیدمیولوژیک بیماری وجود دارد، نشان دهنده این است که هر کانونی به اصول و روش­های کنترلی خاص خود نیاز دارد (33). علی رغم این اهمیت، بیماری اغلب در مناطق کمتر رشد یافته کشورهای در حال توسعه و در برخی از کشورهای مناطق گرمسیر و نیمه گرمسیر دنیا شیوع داشته و موارد ابتلای سالانه آن بیش از نیم میلیون نفر می­باشد (11 و 34). لیشمانیوز احشائی یکی از بیماری­های عفونی–انگلی سیستمیک زئونوتیک (ZVL) شایع می­باشد، که به­عنوان یک مشکل بهداشتی در برخی از کشورهای مناطق گرمسیر و نیمه گرمسیر مطرح می­باشد (21 و 29). لیشمانیوز احشائی جزء بیماری­های اندمیک ایران و بیش از 80 کشور جهان محسوب می­شود و همه ساله نزدیک به 500000 مورد جدید لیشمانیوز احشائی در سال از نقاط مختلف جهان گزارش می­شود (3، 12 و 17). لیشمانیوز احشائی در کشورهای خاورمیانه گسترش زیادی دارد. عامل لیشمانیوز احشائی در ایران لیشمانیا اینفانتوم نوع مدیترانه­ای می­باشد. سگ­ها (Canis Familaris) به­عنوان میزبان اهلی و شغال­ها (Canis aureus) ، روباه­ها (Vulpes vulpes) و گرگ­ها (Canis lupus) به­عنوان میزبانان وحشی، اصلی­ترین مخزن CVL هستند (3، 5 و 20). لیشمانیا اینفانتوم توسط پشه خاکی­های خانواده سیکودیده (Psychodidae) منتقل می­شود. پشه­های خاکی­ ناقل لیشمانیا به انسان و پستانداران حساس بیشتر متعلق به جنس­های فلبتوموس (Phlebotomus)  و لوتزومیا (Lutzoumyia) بوده و انگل را بین مخازن حیوانی و انسان انتقال می­دهند (4، 19 و 20). سگ­های بدون علامت مهم­ترین منبع برای پشه خاکی­های ناقل جهت انتقال انگل به انسان­ها می­باشند (20). تاکنون حداقل چهار کانون اندمیک این بیماری در مناطقی از استان­های اردبیل شهرستان­های مشکین شهر و مغان (گرمی، پارس­آباد و بیله سوار)، آذربایجان شرقی (کلیبر، اهر و آذرشهر)، فارس(جهرم، قیر و کازرون)، سمنان، بوشهر و قم (13) و کرمان و کرج مورد مطالعه و تأیید قرار گرفته­اند، و هر ساله موارد تک گیر لیشمانیوز احشائی از سایر نقاط ایران گزارش می­گردد. در کانون­های اردبیل و آذربایجان شرقی انگل لیشمانیای جدا شده از مخازن حیوانی، بعد از آزمایشات بیوشیمیائی (ایزو آنزیم)، از نوع انگل لیشمانیا اینفانتوم LON49  تعیین گردید، این انگل دقیقأ همان سویه­ای است که در موارد زیادی از افراد مبتلا به کالاآزار در استان­های یاد شده جدا شده است، بنابراین، به­طور قطعی می­توان گفت
سگ­سانان مبتلا به لیشمانیوز احشائی مهم­ترین مخازن حیوانی این عفونت برای انسان محسوب می­شوند (2، 20 و 32). استفاده از روش­های سرولوژی معتبر در شناسائی به موقع این عفونت در مخازن اهمیت فراوانی دارد. تعدادی از تست­ها بر پایه ارزیابی آنتی­بادی­های ضد لیشمانیا تهیه شده است، روش IFAو ELISA یکی از بهترین روش­های سرولوژیکی
می­باشند که حساسیت و ویژگی بالائی برای آن گزارش شده است (3 و 20). با توجه به شرایط اکولوژیک شهرستان سراب هدف از این تحقیق مطالعه اپیدمیولوژیکی شیوع سرمی لیشمانیوز احشائی بین سگ­سانان وحشی شهرستان سراب (آذربایجان شرقی) و نقش احتمالی سگ سانان وحشی در انتقال این بیماری به انسان می­باشد، برای اولین بار مطالعه­ای با دید اپیدمیولوژیک راجع به وضعیت کنونی این بیماری در سگ­سانان وحشی شهرستان طی سال 1388 به اجرا در آمد.

مواد و روش­­ها

منطقه مورد مطالعه و موقعیت جغرافیایی:

شهرستان سراب با وسعتی معادل 2/3452 کیلومتر مربع 71/7 % از کل مساحت استان آذربایجان شرقی را به خود اختصاص داده است و از این لحاظ رتبه سوم را بین شهرستان­های استان دارا می‌باشد. از شمال به شهرستان­های مشکین شهر و هریس از شرق به استان اردبیل از جنوب به شهرستان میانه و از غرب به شهرستان بستان آباد محدود است. ارتفاع این شهرستان از سطح دریا 1650 متر می­باشد و دارای آب و هوای کوهستانی می­باشد (31). این تحقیق جهت بررسی شیوع سرمی لیشمانیوز احشائی زئونوتیک (ZVL)  در میان سگ­سانان  اطراف شهرستان سراب و بررسی احتمال، وجود ارتباط بین سگ­سانان وحشی آلوده، در انتقال انگل به انسان در سال 89-88 انجام گردید. در این مطالعه 10 قلاده روباه و  2 قلاده گرگ جهت تشخیص لیشمانیوز احشائی بروش ایمونوفلورانس غیر مستقیم (IFA) و روش الایزا (ELISA) شکار شدند. از آنجایی که تاکنون مطالعه­ای راجع به خصوصیات اپیدمیولوژیک عفونت احشائی لیشمانیا اینفانتوم در شهرستان سراب انجام نشده بود، مطالعه حاضر با دید سرواپیدمیولوژی برای اولین بار در آن شهرستان طی سال 1388 انجام پذیرفت. با هماهنگی صورت گرفته با ادارات کل دامپزشکی، بهداشت و محیط زیست استان آذربایجان شرقی 10 قلاده روباه و 2 قلاده گرگ از مهر 1388 تا شهریور 89 توسط محیط­بانان ادراه کل محیط زیست استان (سراب) شکار و در اختیار گروه تحقیق قرار گرفت. روباه­ها عمدتاً در اطراف شهر سراب و در نزدیکی­های روستا­ها با استفاده از اسلحه شکاری هدف قرار گرفتند. 2 قلاده گرگ مورد نظر، یکی در حوالی روستای اردها و دیگری در محل دفع زباله­های شهر سراب شکار شدند. لازم به ذکر است تمامی مشخصات حیوانات شکار شده از نظر سن، جنس، رنگ و حتی محل و معاینات بالینی از نظر وجود علایم لیشمانیوز احشائی (ضایعات جلدی، ریزش مو، لاغری،  زخم پوزه، بزرگی و پیچیدگی ناخن­ها، لنفادنوپاتی موضعی یا عمومی، کراتیت، بزرگی شکم و اسهال) معاینه شده و در فرم­های خاصی که به این منظور تهیه شده بود، ثبت گردید. بعد از شکار سگ­سانان وحشی بلافاصله کالبد گشائی شده و حدود   10 میلی­لیتر خون قلبی داخل لوله­های پلی­پرو­پیلن (Polypropylene) توسط سرنگ کشیده شد، بعد از گذشت 10-6 ساعت، نمونه­های اخذ شده به آزمایشگاه منتقل و با استفاده از تکنیک­های آزمایشگاهی و سانتریفیوژ با دور g 800 به مدت 15-10 دقیقه اقدام به جداسازی سرم­ها گردید. در مرحله بعد سرم­ها در داخل میکروتیوب­های اپندروف 1 میلی لیتری تقسیم و در 20- درجه سانتی­گراد نگه­داری شدند. در نهایت سرم­ها جهت انجام تست­های الیزا و ایمونوفلورسانس غیرمستقیم آماده گردیدند. جهت تست ایمونوفلورسانس غیر مستقیم و الیزا کیت­های تشخیصی لیشمانیا اینفانتوم سگی،  تولیدی شرکت  IDvet فرانسه با نام تجاری(Id screen®, Paris, France) استفاده گردید. در این بررسی آنتی IGg سگ کونژکه با ایزوتیوسیانات فلورسین (Sigma®)  F4012 از بخش انگل شناسی دانشکده بهداشت دانشگاه علوم پزشکی تهران تهیه گردید. تیتر این کونژوگه 1:50 بود. بر اساس مطالعات محققین قبلی و با استفاده از آزمون  میانگین هندسی عکس آنتی بادی و در نظر گرفتن سایر مطالعات انجام شده در منطقه تیتر مثبت برای آزمایش ≥1:80 تعیین گردید و تیتر سرمی  مساوی و بزرگتر از 1:80 به­عنوان مثبت تلقی گردید. در مورد الیزا بر اساس دستورالعمل شرکت سازنده کیت درصد OD نمونه برOD کنترل مثبت اگر بزرگتر و مساوی 50% بود، به­عنوان مثبت مورد قبول بود (جدول 1). در نهایت نمونه­ها با استفاده از دستگاه الیزا خوان (Dynatech Laboratories, Roseville, Canada) و میکروسکوپ فلورسنت (Olympus B×50, Japan) مورد مطالعه قرار گرفتند. برای نشان دادن لیشمانیا اینفانتوم در سگ سانان وحشی کالبد شکافی شده، در محل کالبد شکافی ابتدا دو عدد گسترش تماسی از طحال یا کبد گرفته و بلافاصله با الکل متانل 95 درصد فیکس شده و در نهایت در آزمایشگاه میکروبیولوژی دانشکده بهداشت تبریز با رنگ آمیزی گیمسا 10% نمونه­ها مورد
بررسی­های پارازیتولوژی از نظر جسم لیشمن قرار گرفتند. جهت مطالعات هیستوپاتولوژیکی قطعاتی کوچکی از طحال، کبد، کلیه، ریه، غدد لنفاوی مزانتریک و قلب برداشت شد. قطعات در فرمالین 10% به بخش پاتولوژی دانشکده دامپزشکی دانشگاه آزاد واحد علوم و تحقیقات انتقال گردید. در ادامه بخش کوچکی از طحال و کبد حیوانات را در
محیط­های کشت اختصصاصی لیشمانیا اینفانتوم در  NNN, RPMI 1640 و محیط کشت اشنایدر همراه با 20% سرم جنینی گاو کشت داده شدند. پروماستیگوت­های جدا شده در محیط کشت تولید انبوه شدند. جهت استخراج  DNAروش فنل– کلروفرم استفاده گردید (14). در نهایت توسط پرایمرهای اختصاصی KDNA

(F1, 5′- (TCGCAGAACGCCCCTACC) R1, 3′-(AGGGGTTGGTGTAAAATAGG)) با تکنیک       PCR آنالیز شدند.

یافته­ها

    در این بررسی جمعاً تعداد 10 نمونه سرم روباه و 2 نمونه سرم گرگ تهیه شد و نمونه­ها در آزمایشگاه تک یاخته شناسی دانشکده بهداشت وتغذیه دانشگاه علوم پزشکی تبریز با استفاده از تست­های سرولوژیکی مورد آزمایش قرار گرفتند. در این بررسی 1 روباه از 10 روباه شکار شده با تست­های IFA و ELISA به صورت سرم مثبت گزارش گردید. میزان تیتر IFA بزرگتر یا مساوی 1:1280 بود و میزان جذب نوری در ELISA برابر با127/2 (138%=درصد نمونه (S/P%) بود، روباه مذکور علایم مشخص بیماری شامل ضایعات جلدی، ریزش مو، لاغری، بزرگی و پیچیدگی ناخن­ها، هپاتواسپلینومگالی بود. در لام­های گسترش تماسی تهیه شده از کبد و طحال این روباه جسم لیشمن مشاهده و نتیجه کشت هم مثبت بود. در این مطالعه از 2 گرگ شکار شده هیچ کدام به صورت سرم مثبت گزارش نگردید و نتیجه کشت هم منفی بود. انگل­های ایزوله شده از روباه سرم مثبت جهت انجام PCR به مرکز تحقیقات کاربردی و دارویی دانشگاه علوم پزشکی تبریز منتقل و با استفاده از پرایمرهای اختصصاصی k-DNA  آزمایش PCR شد و به طور اختصاصی متعلق به جنس لیشمانیا بود (نگاره 1). تعیین توالی قطعی از طریق Sequencing صورت گرفت. برای تعین توالی نمونه مثبت PCR به مؤسسه تحقیقاتی MWG آلمان ارسال گردید. نتایج توالی با استفاده از نرم افزار BLAST بررسی شد و نمونه مربوط به انگل جدا شده از روباه به طور اختصاصی دارای 99% همولوژی با complex Donovani
(L. infantum, L. donovani, L. Chagasi) بود. برای تعیین توالی قطعی باید از قطعات ژنی دیگر یا از روش­های اختصاصی دیگر همچون ایزوآنزیم استفاده کرد. در این مطالعه مشخص گردید گوشتخواران وحشی میزبانان اصلی برای لیشمانیوز احشائی در شهرستان سراب از استان آذربایجان شرقی هستند. در مشاهدات هیستوپاتولوژیکی تعداد ماکروفاژهای آلوده به انگل در مغز استخوان کمتر از طحال بود. فضای سینوزوئیدال طحال حاوی ماکروفاژهای زیادی بود که که داخل سیتوپلاسم آنها ارگانیسم­های گردی، گاها به شکل C موجود بود. ارتشاح میان بافتی و ادم مشاهده گردید. طحال فیبروزه و مملو از ذرات مالپیگی و بسیار پر خون بود و هیستوسیت­های آلوده در پالپ­ها و ترابکولاها به فراوانی حضور داشتند. به­دلیل نکروز و فیبروز نواحی مربوط به
سلول­های T پالپ سفید طحال تا حد زیادی کوچک شده و تعداد لنفوسیت­ها و تجمع شدید PAS مثبت در قسمت­های داخلی گزارش شد. داخل سلول­های بیگانه خوار تک هسته­ای، اشکال آماستیگوت لیشمانیا دیده می­شود (نگاره 4)، این ارگانیسم­ها با هسته وزیکولار همراه با یک کینتوپلاست داخل سلول­های بیگانه خوار تک هسته­ای دیده می­شود (نگاره 6). داخل تعدادی از ماکروفاژها تجمعات رنگدانه هموسیدرین آشکار بود. پالپ سفید مملو از فولیکول­های لنفاوی بزرگ شده بود و در پالپ قرمز سلول­هائی با تراکم بالا و مقداری خون مشاهده شد. افزایش ماکروفاژها چشمگیر بود (نگاره 5). در غدد لنفاوی کاهش لنفوسیت­ها و در کبد افزابش سلول­های کوپفر کبدی و وجود سلول­های التهابی همراه با دژنرسانس سلول­های کبدی و مشاهده اجسام لیشمن به میزان کمتر از طحال داخل سلول­های کوپفر بود.

جدول 1- رفرانس­های مربوط به کیت تجاری لیشمانیا اینفانتوم

وضعیت

نتیجه

منفی

مشکوک

مثبت

درصد نمونه (S/P%)≤40%

50%> درصد نمونه (S/P%)>40%

درصد نمونه (S/P%)≥50%

درصد نمونه (S/P%) OD = نمونه/ OD کنترل مثبت×100

 

 

 

نگاره 1-  ژل الکتروفورز محصولات

 PCR K-DNA در نمونه­های مختلف": :M-مارکر100جفت بازی،A- کنترل منفی بدون  DNA1و2- نمونه مثبت سگ­ها، 3-نمونه مثبت روباه، 4- لیشمانیا اینفانتوم استاندارد MCAN/IR/96/LON49) آزمایشگاه دانشکده بهداشت دانشگاه علوم پزشکی تهران (750 جفت بازی)

 

 

 

 

 

 

 

 

 

 

نگاره 2- نمونه برداری از روباهای شکار شده در منطقه سراب

 

 

نگاره 3-  روباه مبتلا به لیشمانیوز احشائی

 

 

نگاره 4-  طحال روباه حاوی سلول­های بیگانه خوار تک هسته­ای که داخل سیتوپلاسم آنها اشکال آماستیگوت لیشمانیا دیده می­شود (رنگ­آمیزی H&E، بزرگنمایی 10× ).

 

 

نگاره 5-  طحال روباه سرم مثبت که در داخل سلول­های بیگانه خوار تک هسته­ای، اشکال آماستیگوت لیشمانیا دیده می­شود (رنگ­آمیزی  H&E، بزرگنمایی 100×).

 

 

 

نگاره 6-  ارگانیسم­هایی با هسته وزیکولار همراه با یک کینتوپلاست داخل سلول­های بیگانه خوار تک هسته­ای دیده می­شود (رنگ­آمیزی  H&E، بزرگنمایی10×).

 

بحث و نتیجه‌گیری

     سازمان بهداشت جهانیWHO  عفونت ناشی از L.infantom را به­عنوان یکی از بیماری­های مشترک مهم محسوب می­کند (12). لیشمانیوز احشائی نوع مدیترانه­ای یکی از مهم­ترین و خطرناک­ترین بیماری­های قابل انتقال از حیوان به انسان می­باشد. سگ و سگ سانان وحشی (روباه و شغال)
مهم­ترین مخازن حیوانی لیشمانیوز احشائی در مناطق اندمیک ایران به­شمار می­روند (2). سگ به عنوان مهم­ترین منبع عفونت در مناطق اندمیک لیشمانیوز احشائی در ایران می­باشد (3، 6 و 23). تشخیص روتین انگل با مشاهده آماستیگوت­های انگل در اسمیرهای تهیه شده از طحال و مغز استخوان می­باشد، اگرچه آزمایش میکروسکوپی سریع ارزان و راحت است ولی فاقد حساسیت لازم به هنگامی که تعداد انگل در بافت کم است می باشد. و از طرفی قادر به تشخیص گونه­های انگل می­باشد. تست IFA کاملاً حساس و اختصاصی است و به­عنوان یک تست کیفی در تشخیص لیشمانیوز کاربرد دارد. تفسیر این آزمایش از اهمیت بالایی برخوردار است (2). مطالعات محققین در ایران نشان می­دهد که لیشمانیا اینفانتوم Lon49 عامل اصلی بیماری در انسان و حیوانات مخزن در قسمت­های مختلف ایران می­باشد (3، 25 و 26). طی مطالعه توسط ندیم و همکاران (1984) که در منطقه شمال ایران به منظور بررسی مخازن حیوانی لیشمانیوز احشایی صورت گرفت، 20 قلاده شغال و 10 قلاده روباه مورد کالبدشکافی قرارگرفتند یک شغال زرد (Canis aureus) دارای علایم بالینی (ضعف، لاغری، ریزش مو و زخم ناحیه پوزه) بود. محل صید این شغال
منطقه­ای بین ساری و نکا در شرق دریای خزر بود و در یک روباه ظاهراً سالم و بدون علایم بالینی در ناحیه شرقی سلسله جبال البرز در 15 کیلومتری شرق شاهرود، توانستند آماستیگوت­های انگل لیشمانیا را به تعداد کم مشاهده کنند (25). در بررسی حمیدی (1359) در منطقه شمال ایران، از مجموع 161 قلاده شغال تعداد 8 قلاده آلوده تشخیص داده شدند (16). در مطالعه محبعلی و همکاران (2001) روی 30 سگ­سان وحشی (10 روباه، 10 شغال و 10 گرگ) تنها در 1 روباه، 1 شغال و1 گرگ لیشمانیا اینفانتوم گزارش گردید (24). در تحقیقی که به منظور بررسی اپیدمیولوژی لیشمانیوز جلدی و احشایی و تعیین مخازن آنها توسط محبعلی و همکاران (2001) در شهرستان دشتی و دشتستان، استان بوشهر در طی سال­های (79-77)  انجام گرفت، پس از مطالعه روی 4 روباه، 10 شغال مشخص گردید که یک قلاده از شغال­ها هم از نظرسرولوژیکی و هم از نظر پارازیتولوژیکی نسبت به لیشمانیوز احشایی مثبت بود (24). در مطالعه Courtenay و همکاران (2002) در برزیل روی 37 روباه 29 قلاده (78%) به صورت سرم مثبت گزارش شدند (9). در تحقیق  Dipinetoو همکاران در سال 2007 روی 50 قلاده روباه در جنوب ایتالیا با استفاده از روش  PCR ،20 قلاده به­صورت مثبت بودند (10). در مطالعه Mancianti و همکاران (1994) که در ایتالیا با استفاده از تست IFA و ELISA صورت گرفت 18% روباه­ها دارای آنتی­بادی­های ضد لیشمانیا بودند (18).  Bettiniو همکاران در سال 1980 در ایتالیا روی 35 قلاده روباه شکار شده تنها نتیجه کشت 4 روباه در هامستر را مثبت گزارش کردند (8). در بررسی Sobrino و همکاران در سال 2008 روی 39 گرگ و 162 روباه در اسپانیا با استفاده از روش PCR-RFLP به ترتیب 8 و 23 قلاده مثبت گزارش کردند (30). با جدا نمودن انگل از طحال و کبد یک روباه با روش­های پارازیتولوژی و تعیین گونه انگل با روش­های مولکولی نقش سگ­سانان وحشی به­عنوان یکی از مخازن بیماری که می­بایست در برنامه­های کنترلی در نظر گرفته شوند. نکته‌­ای که می‌توان به عنوان یک فرضیه‌ جدید عنوان نمود، این­ است که ممکن است سویه‌های متفاوتی از انگل Leishmania infantum در منطقه وجود داشته باشد، طوری که این سویه‌ها از نظر ایجاد بیماری و یا خصوصیات آنتی‌ژنیک با یکدیگر متفاوت باشند. بنابراین، اثبات این نکته نیاز به مطالعه‌ دقیق ملکولی و تعین ژن مسئول بیماری در سویه‌های جدا شده از سگ­سانان دارد. بنابراین جهت کنترل لیشمانیوز احشائی در مناطق اندمیک توصیه می­شود، با اجرای دقیق برنامه­های کنترلی تمامی سگ­های آلوده معدوم شده و سگ­های صاحبدار به­وسیله آزمایش­های سرولوژی غربالگری شده و در صورت مثبت بودن آزمایشات فوق، نسبت به معدوم کردن آنها اقدامات لازم صورت گیرد (2 و 28). در نهایت درمان افراد مبتلا به­صورت جدی همراه با کنترل پشه­های ناقل به شرطی که باعث تخریب محیط زیست و ایجاد خطرات بهداشتی در انسان نشود و تنظیم برنامه­های کنترلی اقدامی مؤثر در پیشگیری از بیماری لیشمانیوز احشائی خواهد بود (7 و 15).

  1. محبعلی، م.، فلاح،  ا.، جمشیدی، ش. و حجاران، ه. .1380. ارزیابی روش سرولوژی الیزا با استفاده از آنتی‌ژن فیگوره در تشخیص آزمایشگاهی عفونت لیشمانیوز احشایی سگ. مجله دانشکده دامپزشکی دانشگاه تهران، دوره 56، شماره 3، صفحات: 32-29 .
  2. محبعلی، م.، حمزوی، ی.، فلاح، ا. و زراعی، ز. 1380.مطالعه لشمانیوز احشائی در سگ­های بعضی از مناطق ایران و اهمیت بهداشتی آن. مجله دانشکده دامپزشکی دانشگاه تهران، دوره 56، شماره 3، صفحات: 59-55.
  3. محبعلی، م. ، بهمن رخ، م. ، موسوی فر، الف. 1376. مطالعه انگل‌شناسی و هیستوپاتولوژی لیشمانیوز احشائی در تعدادی از سگ­های شهرستان مشکین شهر. پژوهش و سازندگی، شماره 37، سال 10، جلد 4، صفحات: 125-122.
  4. فرشچیان، م. 1380. تعیین و مطالعه مخازن لیشمانیوز احشائی در منطقه آذرشهر استان آذربایجان شرقی در سال 83-82. پایان نامه برای اخذ درجةفوق لیسانس انگل شناسی،  دانشکدة پزشکی دانشگاه علوم پزشکی تبریز،, صفحات: 49-3.
  5. Abranches, P., Silva-Pereira, M.C.D. Conceiao-Silva, F.M., Santos-Gomes, G.M.J, and J.G. 1991. Canine Leishmaniosis pathological and ecological factors influencing transmission of Infection. J. Parasitol. 77: 557-561.
  6. Ashford, D.A., Badaro, R., Eulalio, C., Freire, M., Miranda, C., Zalis, M.G., and et al. 1993. Studies on the control of visceral leishmaniasis: validation of the Falcon assay screening test-enzyme linked immunosorbent assay (FAST-ELISA) for field diagnosis of canine visceral leishmaniasis. Am. J. Trop. Med. Hyg. 48: 1–8.
  7. Ashford, R.W. 1997. The leishmaniasis as model zoonoses. Ann. Trop. Med. Parasitol. 91: 693-701.
  8. Bettini, S., Pozio, E., Gradoni, L. 1980. Leishmaniasis in Tuscany (Italy) (II) Leishmania form wild Bodentia and Carnivora in a human and canine leishmaniasis focus. Trans. R. Soc. Trop. Med. Hyg. 74(1):77-83.
  9. Courtenay, O., Quinnell, R.J., Garcez, L.M.  Dye. C. 2002. Low infectiousness of a wildlife host of Leishmania infantum the crab-eating fox is not important for transmission. Parasitology. 125: 407-14.
  10. Dipineto, L., Manna, L., Baiano, A., Gala, M., Fioretti, A., Gravino and et al. 2007. Presence of Leishmania infantum in Red Foxes (Vulpes vulpes) in Southern Italy. Journal of Wildlife Diseases. 43(3): 518-20.
  1. Desjeux, P. 2004. Leishmaniasis; current situation and new perspectives. CIMID. 27: 305-318.
  2. Hamidi, A.N. 1982. Visceral Leishmaniasis of Jackals and dogs in northern Iran. Trans. R. Soc. Trop. Med. Hgy. 26: 7-256.
  3. Mancianti, F., Mignone, W., Galestri. F. 1994. Serologic survey for leishmaniasis in free-living red foxes (Vulpes vulpes) in Italy. Journal of Wildlife Diseases. 30: 454–56
  4. Mohebali, M., Hamzavi, Y., Edrissian, G.H. 2001. Seroepidemiological study of visceral leishmaniasis among humans and animal reservoirs in Bushehr province, Islamic Republic of Iran. East Mediterr Health. J. 7:912-17.
  5. World Health Organization. 1990. The leishmaniases, Report of a WHO Export committee World Health Organization. Geneva. pp793.
  6. World Health Organization. 1980. The Leishmania report of a W.H.O exports committee, Technical Report Series. p: 101.
  1. Fallah, E., Farshchian, M., Mazlomi, A., Majidi, J., Kusha, A., Mardi, A., and et al. 2006. Study on the prevalence of visceral leishmaniasis in rodents of Azarshahr district (New focus), North West of Iran. Archives of Razi Institate. 61(7): 27-33.
  2. Fakhar, M., Mohebali, M., Barani, M. 2004. Introduction of an endemic focus of kala-azar in Ghom province and seroepidemiological survey on visceral leishmaniasis in human and animal Reservoirs (dogs) in this area. Armaghane-danesh. Journal. 33: 43-52.
  3. Farajnia, S., Alimohammadian, M.H.  Reiner, N.E.  Karimi, M. Ajdari, S. Mahboudi. F. Molecular characterization of a novel amastigote stage specific Class I nuclease from Leishmania major. International Journal for Parasitology. 34: 899–08.
  4. Handemir, E., Oncel, Z., Kamburgil, T. 2004. Seroprevalence of visceral Leishmaniasis in stray Dogs in Istanbul. T.P.D. 28(3): 123-125.
  1. Khorshidian, S., Hajjaran, H., Sarkissian, M.T., Edrissian, Gh. H. 1994. Evaluation of ELISA, using intact promastigotes as antigen, for diagnosis of visceral leishmaniasis. Iran. J. Med. Sci.19 (1, 2): 15-18.
  1. Mohebali, M., Hajjaran, H., Hamzavi, Y., Mobedi, I., Arashi, S., Zarei, Z., and et al. 2005. Epidemiological aspects of canine visceral leishmaniosis in the Islamic Republic of Iran. Vet. Parasitol. 129: 243–51.
  2. Mohebali, M., Fallah, E., Hajjaran, H. 1998. Vaccine trial against Canine Visceral leishemaniasis in the Islamic Repubic of Iran. E. Mediterr. Hlth. J. 4(2): 234-238.
  3. Mohebali, M., Poormohammadi, B., Kanani, A., Hajjaran, H., Edrissian, G.H. 1998. Rodents another group of animal hosts of visceral leishmaniasis in Mesh kin Shahar district, Islamic Republic of Iran. LRS Mediterranean Oriental. 4 (2): 376-378.
  4. Moshfe, A., Mohebali, M., Edrissian, G.H., Zarei, Z., Akhoundi, B., Kazemi, and et al. 2008. Seroepidemiological Study on Canine Visceral Leishmaniasis in Meshkin-Shahr District, Ardabil Province, Northwest of Iran during 2006-2007. Iranian. J. Parasitol. 3(3): 1-10.
  5. Mohebali, M., Parsa, B., Motazedian, M.H., Yaghoobi-Ershadi, M.R., Hajjaran, H. 2002. Identification of Leishmania species from different parts of Iran using a random amplified polymorphism DNA in human, animal reservoirs and vectors. Med. J. Islamic Rep Iran. 15:243-6.
  1. Nadim, A., Hamidi, A.N., Javadian, E. 1982. Present status of Kala-azar in Iran. Am.J.Trop.Med.Hgy, 27: 25-28.
  2. Ozensoy, T. S., Ertabakhar, H., Ozbel, Y., Balcioglu, C., Yildizli, N., Ziya Alkan, M. 2005. Seroprevalence of canine visceral leishmaniasis in kusadasi- Turkey. Turk. J. Vet. Anim. Sci. 29: 23-26.
  3. Ozbel, Y., Oskam, L., Ozensoy, S., Turgay, N., Alkan, M.Z., Jaffe, C.L., and et al. 2000. A survey on canine leishmaniasis in western Turkey by parasite, DNA and antibody detection assays. Acta Trop. 74: 1–6.
  4. Semiao Santos, S.J., Abranches, P. Pereira, S., Games, S., Fernandes, J.P., Vetter, J.C.M. 1996. Reliability of serological Methods for Defection of Leishmaniasis in Portuguese Domestic and wild Reservoirs. Mem. Inst. Oswald .Cru2, Rio de Joneiro. 91(6): 747-750.
  5. Sharifi, I., Daneshvar, H. 1994. The prevalence of visceral leishmaniasis in suspected canine reservoirs in southern Iran. Iran .Ians. Med. Sci. 21(3, 4): 130-134.
  6. Sobrino, R., Ferroglio, E., Oleaga, A., Romano, A., Millan, J., Revilla, and et al.  2008. Characterization of widespread canine leishmaniasis among wild carnivores from Spain. Vet Parasitol. 155(3-4):198-203.
  7. Statistical calendar of East Azerbaijan Province 2002 and management and planning organization east AzerbaijanProvince, GIS Unit.
  8. Taran, M., Mohebali, M., Modaresi, M.H., Manishi, S., Mahamadi, M., Mojarad, M. 2007. Diagnosis of canine visceral leishmaniasis by ELISA using K39sub Recombinant Antigen. Iranian. J. Publ. Health. 39 (2): 1-6.