‌مقایسه چهار روش مشاهده مستقیم، الایزا، کشت و Nested PCR در بررسی آلودگی شیر مخزن دامداری‏ها به باکتری مایکوباکتریوم آویوم تحت گونه پاراتوبرکولوزیس

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد کرج، دانشکده دامپزشکی، گروه علوم بالینی، کرج، ایران

2 دانشگاه آزاد اسلامی، واحد کرج، دانشکده دامپزشکی، گروه پاتوبیولوژی، کرج، ایران

3 دانشگاه تهران، دانشکده دامپزشکی، گروه علوم پایه، تهران، ایران

4 دانشگاه آزاد اسلامی، واحد کرج، دانش آموخته دانشکده دامپزشکی، کرج، ایران

چکیده

عامل بیماری یون، باکتری مایکوباکتریوم آویوم تحت گونه پاراتوبرکولوزیس است و هر ساله زیان فراوانی در سطح جهانی، از قبیل کاهش تولید، افت شاخص­های تولید مثلی و حذف دام مبتلا را متوجه صنعت گاو شیری، می‏نماید. از دیگر سوی، این باکتری را یک پاتوژن زئونوز می­دانند و تحقیقات جدید احتمال می­دهند که این باکتری در ایجاد بیماری کرون در انسان، نقش داشته باشد. هدف این مطالعه مقایسه روش‏های تشخیص آزمایشگاهی الایزا، مشاهده مستقیم، کشت و Nested-PCR در شیر بالک تانک جهت تشخیص آلودگی شیر مخزن گله‏ها به باکتری مایکوباکتریوم آویوم زیرگونه پاراتوبرکولوزیس، می‏باشد. بدین منظور نمونه­گیری از مخزن 100 دامداری صنعتی استان تهران صورت پذیرفت و این نمونه‏ها با هر چهار روش کشت شیر، مشاهده مستقیم، Nested-PCR و الایزا مورد بررسی قرار گرفتند که تعداد 82 نمونه (82%) در محیط کشت مثبت بوده‏اند، 94 نمونه(94%)در تستIS900 Nested PCR مثبت بوده‏اند و 98 نمونه(98%) با الایزا مثبت بوده‏اند. اما از کل نمونه‏های تست شده تنها 33 نمونه(33%) در مشاهده مستقیم مثبت بودند. تعداد چهار نمونه وجود داشت که در تست الایزا مثبت بودند ولی در تست PCR منفی شدند. این چهار نمونه به علاوه 12 نمونه دیگر که الایزای آنها مثبت بود، در مجموع 16 نمونه در محیط کشت، رشد باکتری نداشتند. در مجموع نتایج این مطالعه ارجحیّت Nested PCR بر سایر روش‏های استفاده شده در این تحقیقرا، تأیید می‏نماید.در ضمن نتایج این مطالعه نشان دهنده میزان بالای آلودگی به این باکتری در دامداری­های استان تهران می‏باشد که نیازمند اقدامات جدی­تری است.

کلیدواژه‌ها


عنوان مقاله [English]

Comarison of direct microscopic examination, Enzyme Linked Immunosorbent Assay (ELISA), culture and Nested-PCR for diagnosis of herds bulk tank milk infection with Mycobacterium avium subspecies paratuberculosis

نویسندگان [English]

  • A Badiei 1
  • F Mousakhani 2
  • A Barin 3
  • A Hamidi 4
  • M Zafari 4
1 Department of Clinical Scienece, Faculity of Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran
2 Department of Pathobiology, Faculity of Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran
3 Department of Basic Science, Faculity of Veterinary Medicine, University of Tehran, Tehran, Iran
4 Graduate of Veterinary Medicine, Faculty of Veterinary Medicine, Karaj Branch, Islamic Azad University, Karaj, Iran
چکیده [English]

Causative agent of Johne’s diseases is Mycobacterium avium subspecies paratuberculosis (MAP) and each year, it hurts dairy cattle industry worldwide by depression of production and reproductive indexes and culling of affected animals. This bacteria is known as a zoonotic pathogen and recent researches explain its probable role in Crohn’s disease in humans. This study compared four laboratory diagnostic tests; including Enzyme Linked ImmunoSorbent Assay (ELISA), direct microscopic examination, milk culture and Nested-PCR for diagnosis of herds bulk tank milk infection with MAP bacteria. 100 bulk tank milk samples were obtained from 100 industrial dairy herds of Tehran province. Samples were screened by four tests and 82 samples (82%) detected as positive in culture media, 94 milk samples (94%) were positive by Nested-PCR test and 98 samples were positive in ELISA test results (98%). But direct microscopic examination identified just 33 milk samples as positive. Four positive samples of ELISA test were detected as negative samples by Nested-PCR. These 4 samples in addition to 12 other samples which diagnosed as positive by ELISA, had no growth in culture media (16 samples). These results indicated superiority of Nested-PCR among these four tests for diagnosis of bulk tank milk infection with MAP bacteria. Furthermore, the results represent high prevalence of MAP bacteria in bulk tank milk of dairy herds in Tehran province and it needs more serious eradication efforts.
 

کلیدواژه‌ها [English]

  • Johne’s diseases
  • Mycobacterium avium
  • Subspecies paratuberculosis
  • cattle
  • Nested-PCR
  • Elisa
  • Milk calture
  • Direct microscopic examination

مقدمه

 

    یون یا پاراتوبرکلوز، یک بیماری مزمن عفونی و تحلیل­برنده است که شیوع جهانی دارد و اساساً در نشخوارکنندگان ایجاد می‌شود. عامل این بیماری یعنی باکتری مایکوباکتریوم آویوم تحت گونه پاراتوبرکولوزیس اغلب در گاو و در مقیاس کمتری در نشخوارکنندگان کوچک، یعنی گوسفند و بز وجود دارد و ایجاد بیماری می‌کند. دوره کمون طولانی، اسهال، افت تولید و لاغری مفرط، مشخصه‌های اصلی بیماری در گاو می‌باشند (8 و 20). این بیماری که صنعت دام در سطح جهانی با آن درگیر است، هرساله خسارات فراوانی از قبیل کاهش تولید، افت شاخص­های تولید مثلی و حذف دام مبتلا را متوجه دامداران می‏سازد. گسترش بیماری به بسیاری از کشورها، از طریق صادرات دام­های دارای نژاد اصیل و آلوده که بیماری بالینی نشان نمی‌دادند، صورت پذیرفته است (4، 14 و 15).

در کشور ما ایران هم به دلیل تعداد فراوان دامداری­های صنعتی که از سیستم فشرده نگه­داری استفاده می‏کنند، این بیماری اهمیت ویژه­ای پیدا کرده است و حتی بعد از گذشت چندین سال از شناسایی این بیماری در ایران، هنوز سیاست مناسبی برای مقابله با آن اجرا نشده است (1).

از دیگرسوی، این باکتری را یک پاتوژن زئونوز می­دانند و تحقیقات جدید احتمال می­دهند که این باکتری در ایجاد بیماری کرون در انسان، نقش داشته باشد. عده­ای از محققان نیز بیان می‏کنند که حتی ممکن است بعد از پاستوریزاسیون شیر نیز این جرم بیماری­زا در شیر، زنده باقی بماند و از این طریق به عنوان یک عامل تهدید­کننده سلامتی در سطح جامعه مطرح شود (28، 29، 30 و31).

خسارات اقتصادی مربوط به بیماری یون، به دلیل کاهش راندمان خوراک، کاهش تولید شیر، کاهش چربی و پروتئین شیر، کاهش باروری، افزایش وقوع ورم پستان، حذف زودرس و کاهش وزن لاشه گاوهای حذفی می‏باشد (4، 6، 17 و 23).

به دلیل طبیعت مزمن بیماری و خصوصیات باکتری مولد آن، تست‏های تشخیصی رایج، کفایت لازم را در تشخیص دام آلوده را ندارند و یا از سرعت لازم برخوردار نیستند. همین موضوع یکی از مشکلات اساسی در مبارزه با بیماری در همه سطوح است (8، 20 و 23).

تست‏های تشخیصی رایج، اکثراً تشخیص دام آلوده در سطح انفرادی را هدف قرار داده‏اند و برای شناسایی گله‏های آلوده، تست تشخیصی مشخصی، توصیه نشده است. شناسایی گله آلوده در بررسی همه­گیری­شناسی بیماری و اتخاذ سیاست­های درست در مبارزه با بیماری نقش به­سزایی را بازی می‏کند (12 و 14).

 می­توان از شیر بالک تانک گله، به­عنوان یک ابزار جهت پایش وضعیت کل گله، سود ببریم. به­علاوه این امکان وجود دارد که در صورت شناسایی شیر آلوده، برای تغذیه گوساله­ها از سیاست­های مناسب و فراخور وضعیت هر گله، مانند پاستوریزاسیون، شیر خشک و ... استفاده نمود (10 و 26).

هدف در این مطالعه مقایسه روش­های تشخیص آزمایشگاهی الایزا، مشاهده مستقیم، کشت و Nested-PCR شیر بالک تانک جهت تشخیص آلودگی به باکتری مایکوباکتریوم آویوم زیرگونه پاراتوبرکولوزیس می­باشد.

مواد و روش­ها

روش نمونه‏گیری از شیر مخزن:

  برای نمونه­‌گیری، تعدادی از دامداری‌های صنعتی اطراف تهران در نظر گرفته شدند. این واحدهای دامداری، بین 100 تا 2500 رأس دام دوشا داشتند. نمونه از شیر یک وعده شیردوشی کلیه گاوهای شیری هر وعده اخذ ‏شد.

 قبل از نمونه‌گیری، مخزن کاملاً تخلیه و شستشو ‌شد. سرد کن و همزن تانک بایستی از ابتدا روشن باشد. بعد از اتمام کامل یک وعده شیردوشی کل دام‌های شیری گله و بعد از گذشت حداقل نیم ساعت از اتمام شیردوشی، به منظور هم خوردن کافی شیر و مخلوط شدن آن، نمونه­گیری از درب بالایی تانک صورت گرفت. برای نمونه­گیری ابتدا قیچی و غلاف تلقیح را با الکل 70٪ تمیز نموده و فرصت می‌دهیم تا الکل خشک شود. قسمت انتهایی غلاف را از سمت سبز رنگ  بریده و بر نوک سرنگ سوار می‌کنیم. سپس برای برداشت شیر، به اندازه طول غلاف به عمق شیر رفته و با سرنگ نمونه را بر‌می­داریم و شیر را در داخل ظرف نمونه­گیری استریل می‌ریزیم. حداقل حجم مورد نیاز برای نمونه‌گیری، 100 میلی­لیتر می‌باشد. نمونه‌ها در کنار یخ و در داخل یخچال سفری و یا یخدان یونولیتی، به آزمایشگاه انتقال یافت. زمان­بندی نمونه­گیری به گونه­ای بود که شیر هر دامداری، در همان روز نمونه­گیری و پس از انتقال به آزمایشگاه، کشت داده شد و گسترش جهت مشاهده مستقیم بر روی لام داده ‏شد. در ضمن مقادیر مورد نیاز برای الیزا و PCR به ترتیب درون یخچال و فریزر 70- درجه سانتی­گراد،
نگه­داری شدند. تست الیزا در فاصله ٢٤ ساعت پس از رسیدن نمونه­ها به آزمایشگاه، انجام گردید (10، 16 و 26).

روش انجام تست الایزای شیر:

از تست الایزا جهت اندازه‏گیری کمی آنتی‏بادی علیه عامل بیماری یون موجود در شیر استفاده گردید. در این مطالعه ما از کیت الایزای آنتی­بادی یون ساخت شرکتSVANOVA®  به نام (SVANOVIRTM) استفاده نمودیم. این کیت از روش الایزای غیرمستقیم، جهت اندازه­گیری آنتی‏بادی علیه یکی از آنتی‏ژن‏های باکتریMAP، بهره می‏برد. این آنتی‏بادی در بدن دام آلوده به باکتری MAP، تولید شده و از طریق سرم خون وارد بافت پستان گردیده، از طریق شیر تولیدی دفع می‏گردد (27).

برای آزمایش شیر مخزن، مطابق دستورالعمل خود کیت، مقدار 25 میکرولیتر از شیر را به مدت 10 دقیقه در ×g 2000 سانتریفیوژ کرده و فاز چربی را خارج نمودیم. مایع باقی مانده را به نسبت 1:10 با بافر رقیق­کننده کیت (PBS–Tween) مخلوط ‏کرده و حجم 100 میکرولیتر از این مخلوط درون هر چاهک ریخته ‏شد. برای انجام هر بار تست، از دو کنترل مثبت و منفی در کنار نمونه­ها استفاده گردید. بقیه مراحل تست نیز مطابق دستورالعمل خود کیت صورت گرفت. تفسیر نتایج نمونه‌ها، برأساس نسب OD نمونه به OD کنترل مثبت و منفی، که از رابطه PP (درصد مثبت بودن) محاسبه می‏شود، صورت گرفت (5 و 12)

 

 

روش انجام کشت شیر:

از میان محیط‏های کشت مختلف باکتری مایکوباکتریوم آویوم تحت گونه پاراتوبرکولوزیس (MAP)، محیط کشت هرولداگHerrold’s Egg Yolk Medium (HEYM) ، جهت انجام کشت شیر در این مطالعه انتخاب گردید.  برای انجام کشت به حجم 30 میلی­لیتر از شیر مخزن مورد نیاز است. شیر را در فالکون 50 میلی­لیتری ریخته و به مدت 30 دقیقه، در سرعت rpm  2500 و در دمای اتاق سانتریفیوژ نمودیم. سپس مایعات رویی را دور ریخته و رسوب (Pellet) حاصل را نگه داشتیم. رسوب را در حجم 30 میلی­لیتر از محلول %9/0 هگزا دسیل ­پریدنیوم ­کلراید­ (Hexadecylpyridinium chloride) معلق کرده و به مدت 12 تا 18 ساعت در انکوباتور با دمای 37 درجه سانتی­گراد قرار دادیم تا عمل آلوده­زدایی از شیر صورت پذیرد. بعد از گذشت این زمان، لوله‏ها را از انکوباتور خارج کرده و به مدت 20 دقیقه با سرعت rpm 2500 سانتریفیوژ نمودیم. بر روی رسوب به دست آمده از این مرحله، یک میلی­لیتر از محلول آنتی­بیوتیکی و ضد قارچ، ریخته شد. ترکیب این محلول به ترتیب زیر می‏باشد:

100 μg/ml naladixic acid

100 μg/ml vancomycin

50 μg/ml amphotericin B

مقدار 1/0 میلی­لیتر از هر یک از سوسپانسیون‏های به دست آمد را، به چهار لوله حاوی محیط کشت HEYM منتقل نمودیم که سه عدد از این لوله‏ها حاوی مایکوباکتین است و یک عدد بدون مایکو باکتین بود. سپس لوله‏ها را برای مدت یک هفته با درب نیمه باز، به حالت افقی درون انکوباتور 37 درجه
سانتی­گراد قرار دادیم. هدف از این کار خارج نمودن گازهای اضافه تولیدی و رطوبت اضافی سطح محیط کشت است. بعد از گذشت یک هفته، درب لوله‏های محیط کشت را محکم کرده و لوله‏ها به حالت عمودی درون انکوباتور با دمای 37 درجه سانتی­گراد قرار گرفتند. از هفته ششم، هر هفته یک بار، یک گسترش از سطح محیط کشت تهیه نموده و پس از رنگ­آمیزی ذیل-نیلسون، با میکروسکوپ مشاهده شدند تا نمونه­های مثبت را شناسایی نماییم. این کار را تا هفته بیستم ادامه دادیم. نمونه‏هایی که تا این زمان منفی هستند را منفی در نظر گرفتیم (21 و 25).

روش انجام Nested-PCR شیر:

استخراج DNA:

 برای انجام Nested-PCR  شیر، حجم 10 میلی­لیتر شیر نیاز است. ابتدا باید عمل استخراج DNA از شیر صورت پذیرد و سپس روی DNA استخراج شده، Nested-PCR  انجام شود. جهت استخراج DNA  از نمونه شیر مخزن، شیر را داخل فالکون ریخته و به آن 100 میکرولیتر از Triton X 100   اضافه کرده و به مدت 30 دقیقه با سرعت rpm 4500  سانتریفیوژ نمودیم. لایه چربی و فاز مایع را از فالکون خارج کرده و پلیت به دست آمده را به میکروتیوب 5/1 میلی­لیترمنتقل کردیم.

 بر روی پلیت، 400 میکرولیتر از بافر لیز­کننده مایکوباکتریوم ریخته و به مدت یک شب (Over night) در انکوباتور 37 درجه سانتی‌گراد قرار دادیم. این بافر با استفاده از فرمول زیر قابل ساخت است:

(86.6 ml H2O، 8 ml 5 M NaCL،2 ml 2 M TrisHCl (pH 8) ،3 ml 20% SDS، 400 μl 0,5 M EDTA، 220 μl 15.6 mg/ml proteinase K)

در مرحله بعدی میکروتیوب‌ها را در ظرف حاوی مخلوط گرانول‌های یخ خشک و اتانول وارد کرده و فرصت دادیم تا فریز شوند. بعد بر رویHeat block ، که از پیش بر روی 50 درجه سانتی‌گراد تنظیم شده است، قرار دادیم تا ذوب شوند. این عمل فریز انجماد و ذوب را برای دو مرتبه دیگر تکرار کردیم. در مرحله بعدی 400 میکرولیتر فنل به میکروتیوب‌ها اضافه شد و به مدت 20 ثانیه ورتکس گردید. سپس به مدت دو دقیقه در دمای 4 درجه سانتی­گراد و با سرعت rpm 13000 سانتریفیوژ کرده و فاز مایع را به یک میکروتیوب جدید انتقال دادیم. همان مرحله را با مخلوط فنل/ کلروفرم/ ایزوآمیل الکل که به نسبت 25:24:1 مخلوط شده‌اند، تکرار نمودیم و یکبار نیز با کلروفرم/ ایزوآمیل الکل که به نسبت 24:1 مخلوط شده‌اند، این عمل تکرار شد. به آخرین فاز مایعی که به­دست می‌آمد، 40 میکرولیتر از سدیم استات 3 مولار و 800 میکرولیتر از اتانول خالص اضافه کرده و به خوبی مخلوط نمودیم.

سپس میکروتیوب‌ها را برای 30 دقیقه در فریزر 70- درجه سانتی‌گراد قرار داده و بعد از آن به مدت 20 دقیقه، در دمای 4 درجه سانتی­گراد و با سرعت rpm 13000 سانتریفیوژ کردیم تا DNA  رسوب کند. رسوب DNA  را با 800 میکرولیتر اتانول سرد (Ice cold) شستشو داده و به مدت 5 دقیقه، در دمای 4 درجه سانتی­گراد و با سرعت rpm 13000 سانتریفیوژ کردیم و بعد قسمت بالایی را خشک کرده و پلیت را خشک نمودیم. آنگاه بر روی پلیت DNA، 50 میکرولیتر از بافر TE ریخته شد و DNA استخراج شده را در دمای 20- درجه سانتی‌گراد، نگه­داری نمودیم (2، 3 و 10).

مواد و برنامه انجام Nested-PCR

جهت بررسی وجود باکتری Map در شیر مخزن، تست Nested PCR با استفاده از پرایمر اختصاصی IS900، استفاده شد. توالی پرایمر‌ها بر طبق روش Stabel و همکاران از محققان مرکز ملی بیماری‌های حیوانات ایالات متحده، انتخاب شد. پرایمر‌ها ساخت کمپانی MWG آلمان بودند. برای انجام PCR، از ترمال سایکلر گرادیانت ساخت شرکت ESCO مدل Swift™ Maxi استفاده شد (26).

توالی جفت پرایمر خارجی به ترتیب زیر است و اندازه قطعه هدف آن bp  400 می‌باشد.

MP 1 forward →5'-GTTCGGGGCCGTCGCTTAGG-3'

MP 2 reverse →5'-GAGGTCGATCGCCCACGTGA.- 3'

توالی جفت پرایمر داخلی نیز به ترتیب زیر است و اندازه قطعه هدف آن bp 198 می‌باشد.

NMP 2 forward → 5'- GCTTAGGCTTCGAATTGCC - 3'

NMP 2 reverse → 5'- CTCCGTAACCGTCATTGTCC - 3'

در مرحله اول، در طول یک برنامه دمایی، سکانس هدف در DNA استخراج شده از نمونه‌ها، در صورت وجود ازدیاد می‌یابد و تکثیر می‌شود. اندازه قطعه هدف این مرحله bp400 می‌باشد. در جدول شماره 1، مقدار غلظت مولاری و حجم مورد نیاز هر یک از مواد مصرفی در مرحله اول PCR که جفت پرایمر‌های خارجی در آن عمل می‌کنند، آمده است (26). 

 

 

 

جدول 1- مقدار غظت و حجم مواد مورد نیاز PCR مرحله اول

 

مقدارحجم مورد نیاز

غلضت نهایی

ترکیبات

ردیف

Lμ33.5

 

D.W.

1

Lμ5

1X

10X PCR Buffer

2

Lμ1

0.2 mM of each

dNTP mix (10 mM)

3

Lμ2

2 mM

Forward primer MP1 (10 pmol/μl)

4

Lμ2

2 mM

Reverse primer MP2 (10 pmol/μl)

5

Lμ0.5

1.25 u/50μl

Taq DNA Polymerase (5u/μl)

6

Lμ3

1.5 mM

MgCl2 (25 mM)

7

Lμ5

 

Template DNA

8

Lμ50

حجم نهایی


برنامه دمایی مرحله اول ، به شرح زیر است:

94 درجه سانتی­گراد به مدت 4 دقیقه

94 درجه سانتی­گراد به مدت 1 دقیقه

62 درجه سانتی­گراد به مدت 1 دقیقه

72 درجه سانتی­گراد به مدت 1 دقیقه و 30 ثانیه

تکرار مراحل 2 تا 4 برای 30 مرتبه

94 درجه سانتی­گراد به مدت 7 دقیقه

 

 

در مرحله دوم، محصول PCR  مرحله قبل به یک میکروتیوب جدید منتقل شد و به عنوان الگو استفاده گردید. در این مرحله قطه توالی کوچک‌تر، که در دل قطعه اول جای دارد، با طول bp 198 تکثیر می‌گردد. برنامه دمایی مرحله دوم، مانند مرحله اول است، با این تفاوت که تعداد سیکل‌ها در این مرحله 25 سیکل است (26).   

 

 

 

 

 

 

 

 

 

 

جدول 2- مقدار غظت و حجم مواد مورد نیاز PCR مرحله دوم

مقدارحجم مورد نیاز

غلضت نهایی

ترکیبات

ردیف

Lμ34.5

 

D.W.

1

Lμ5

1X

10X PCR Buffer

2

Lμ1

0.2 mM of each

dNTP mix (10 mM)

3

Lμ2

2 mM

Forward primer NMP1 (10 pmol/μl)

4

Lμ2

2 mM

Reverse primer NMP2 (10 pmol/μl)

5

Lμ0.5

1.25 u/50μl

Taq DNA Polymerase (5u/μl)

6

Lμ3

1.5 mM

MgCl2 (25 mM)

7

Lμ2

 

Template DNA

8

Lμ50

حجم نهایی


جهت بررسی محصول PCR از ژل آگارز 2٪، رنگ­آمیزی
به­وسیله رنگ اتیدیوم بروماید وDNA Marker 100bp استفاده گردید (2 و 3). 

روش انجام مشاهده مستقیم

برای اجرای این روش، ابتدا مقدار 10 میلی­لیتر شیر را در g2500 سانتریفیوژ نموده و رسوب آن با استفاده از حرارت بر روی لام فیکس شد. سپس لام به روش ذیل نیلسن رنگ­آمیزی شد. به این منظور، بر روی لام کربول فوشیل ریخته شد و بعد از گذشت 15 دقیقه با اسید الکل، به مدت 15 دقیقه و به دفعات متعدد رنگ­زدایی انجام شد. سپس رنگ متیلن بلو به مدت بیست ثانیه بر روی لام ریخته شد و بعد با آب شسته و اجازه داده شد تا با هوا خشک گردد. لام با لنز 100X میکروسکوپ، به همراه روغن امولسیون، مشاهده شد (19).

یافته­ها

    از میان 100 نمونه شیر مخزن آزمایش شده در این مطالعه تعداد 82 نمونه (82%) در محیط کشت مثبت بودند و کلنی باکتری Map در آنها رشد نشان داد. ولی در باقی نمونه‏ها، یعنی تعداد 18 نمونه (18%) بعد از گذشت مدت زمان بیست هفته، کلنی در محیط کشت رشد نکرد و این نمونه‏ها در کشت منفی بودند.

از کل 100 نمونه‏، تعداد 94 نمونه شیر در تست IS900 Nested PCR مثبت بوده‏اند (94%).

بر طبق توصیه شرکت سازنده کیت الایزا، نمونه‏هایی که PP  حاصل از تست الایزای آنها کمتر و یا مساوی با 5 باشد را به عنوان منفی تلقی می­شوند. مقادیر  PPبین 5 تا 15 را به عنوان شیوع پایین و مقادیر‏های بالاتر از 16 را به عنوان شیوع بالا می‏شناسیم.

بر این اساس، تعداد 2 نمونه (2%) در محدوده منفی، 66 نمونه در محدوده شیوع پایین (66%) و 32 نمونه در محدوده PP شیوع بالا (32%) قرار داشتند. در این مطالعه شیوع پایین و بالا در تست الایزا را به عنوان مثبت تلقی نمودیم. به عبارت دیگر از مجموع نمونه‏های آزمایش شده، 98% با الایزا مثبت بوده‏اند و تنها 2% منفی داشته‏ایم.

در تست مشاهده مستقیم به کمک رنگ­آمیزی ذیل نیلسن، در 33 نمونه (33%) کلامپ باکتری مشاهده شد.

تعداد چهار نمونه وجود داشت که در تست الایزا مثبت بودند ولی در تست PCR منفی شدند. این چهار نمونه به علاوه 12 نمونه دیگر که الایزای آنها مثبت بود، در مجموع 16 نمونه، در محیط کشت، رشد باکتری نداشتند. 

تعداد 82 نمونه در هر سه تست الایزا، کشت و Nested PCR مثبت بودند (82%).  تعداد 33 نمونه در هر چهار تست انجام شده مثبت بودند. تعداد 12 نمونه وجود داشتند که حاصل کشت آن منفی بوده ولی در Nested PCR و الایزا، مثبت بودند.

بحث و نتیجه‌گیری

    با توجه به نتایج حاصل در این مطالعه، علی­رغم اینکه تست الایزا تعداد بیشتری از نمونه‏ها را به عنوان مثبت اعلام نمود، ولی تعداد چهار نمونه وجود داشت که در تست الایزا مثبت بودند ولی در تست PCR منفی شدند. این چهار نمونه به علاوه 12 نمونه دیگر که الایزای آنها مثبت بود (در مجموع 16 نمونه) در محیط کشت نیز، رشد نداشتند. با توجه به اینکه اکثر منابع موجود، کشت در محیط کشت اختصاصی را به­عنوان استاندارد طلایی در تشخیص باکتری Map می‏شناسند، می‏توان چنین نتیجه گرفت که در تست الایزای شیر مخزن، مثبت کاذب داریم. پس جواب­های مثبت آن برای قضاوت بر روی وضعیت کلی گله، قابل اعتماد نمی‏باشد.

روش مشاهده مستقیم به کمک رنگ آمیزی ذیل نیلسن نیز فقط توانایی شناسایی 33 عدد از موارد مثبت را دارا بود. منابع جدید از جمله OIE این روش را جهت شناسایی Map در شیر و مدفوع مناسب نمی‏دانند. نتایج این تحقیق نیز این موضوع را تایید می‏نماید (20 و 23).

استفاده از مقادیر بالاتر شیر به عنوان نمونه اولیه، شانس جداسازی DNA باکتری Map را بهبود می‏بخشد. از این رو ما در این مطالعه از میزان 10 میلی‏لیتر شیر به عنوان نمونه اولیه در مرحله استخراج DNA، استفاده کردیم.

ما در این مطالعه از Nested PCR برای مطالعه مولکولی DNA استخراج شده از شیر مخزن استفاده کردیم.

مزایای این روش تغییر یافته PCR عبارتند از:

حساسیت در این روش به میزان زیادی بالاتر است.

نیاز به پروب (کاوشگر) و تأییدهای بعدی کمتر است.

ویژگی این روش به­خاطر حضور پرایمرهای درونی بالاتر است. به دلیل انتقال محصول PCR دور اول به لوله جدید، ممانعت کننده­ها رقیق می­شوند. چون در روش استخراج مورد استفاده ما، از فیلتر استفاده نشده است، احتمال حضور
ممانعت­کننده­‌های PCR وجود دارد. همانگونه که اشاره شد، در Nested-PCR به دلیل انتقال محصولات دور اول به لوله جدید، ممانعت کننده‌ها هم رقیق می‌شوند (2 و 3).

تنها مطالعه‏ای که تا حدی با کار ما مشابهت داشت، مطالعه Sharma و همکارانش در هندوستان بود. این مطالعه برای مقایسه الایزای شیر، کشت شیر و  PCR شیر در جهت تشخیص آلودگی یون در گاوهای شیری، صورت پذیرفت. از میان نمونه‏های شیر 50 رأس گاوی که به هر سه روش الایزا، کشت و PCR  بررسی شده بودند، 84 ٪ در کشت مثبت بودند. بر طبق این مطالعه 50٪ از کشت‌های انجام شده از چربی و 62٪ از کشت‌های انجام شده از رسوب مثبت بوده است. محیط کشت مورد استفاده در این مطالعه، یعنی محیط HEYM، همان محیطی است که ما در این مطالعه، از آن استفاده کردیم. الایزا تنها توانست 1/32 ٪ از موارد مثبت را پیدا کند. اما روشی که برای استخراج و PCR  در این مطالعه استفاده شده است، تنها 6٪ از 50 نمونه شیر را مثبت تشخیص داده است. همانطور که دیده می‌شود در این تحقیق حساسیت تست PCR بسیار پایین وحتی پایین‏تر از تست الایزا است. حتی خود آن محققان اذعان داشته‏اند که باید این روش بهینه گردد (22).

این در حالی است که Buergelt و Williams در سال از دانشگاه فلوریدا در مطالعات خود نشان دادند که حتی دام‏هایی که نتیجه تست الایزای آنها، در محدوده مشکوک و منفی بوده، تست Nested PCR شیر می‏تواند مثبت باشد (7).

Nielsen و همکارانش شیر مخزن 900 گله از 6 ناحیه کشور دانمارک را به وسیله تست الایزا مورد بررسی قرار داده‏اند و در مجموع 70% از این گله‎ها آلوده بودند (16).

در مطالعه حق‌خواه و همکارانش در ایران که در استان فارس برای تعیین شیوع بیماری به وسیله PCR  شیر مخزن انجام شد، از 110 گله در سه منطقه استان فارس (شیراز،‌ مرودشت و سپیدان )، تعداد 12 گله (11٪) بر اساس تست IS900-PCR مثبت بوده‌اند. شیوع بیماری در مناطق مختلف تفاوتی از 6/8٪ تا 23٪ نشان می‌دهد. آمار پایین آلودگی گله‏ها در استان فارس با آمار به دست آمده در استان تهران در این تحقیق، تفاوت فاحشی دارد. البته در این مطالعه حجم نمونه شیر مخزن برای استخراج DNA، 5/0 میلی‌لیتر شیر بوده است. استفاده از مقادیر پایین نمونه شانس جداسازی باکتری را کاهش می‌دهد (13).

استفاده از روش‏های مختلف استخراج DNA از نمونه شیر مخزن می‏تواند بر حساسیت PCR تاثیر گذار باشد و با بهبود روش استخراج DNA، می‏توان حساسیت تست را بهبود بخشید. البته باید به این نکته توجه داشت که کاربرد بسیاری از تکنیک‏های استخراج DNA در ایران، به دلیل در دسترس نبودن مواد و تجهیزات لازم، مانند تکنیک Bead beated عملی نیست.

در مطالعه‏ای که Stabel و همکارانش در 61 گله از 10 ایالت کشور آمریکا انجام داده‏اند، نتایج حاصل از الایزا و کشت مدفوع انفرادی گاوها را با نتایج حاصل از  PCR و کشت شیر مخزن گله‏ها، مورد مقایسه قرار داده‏اند. تمام گله‏های انتخاب شده، حداقل یک مورد گاو الایزا مثبت داشتند. از هرکدام از گله‌های تحت بررسی در این مطالعه، علاوه بر نمونه‌گیری شیر مخزن برای PCR،‌ متناسب با سایز گله تعدادی گاو انتخاب شده و از آنها کشت مدفوع به عمل آمد (در مجموع 712 گاو که به صورت اتفاقی از 61 گله انتخاب شده بودند). در این مطالعه 35 فارم ( 68% ) در تست  IS900 Nested-PCR مثبت بودند. جالب توجه‌ اینکه 11 گله ( 4/52%) از گله‌هایی که هیچ مورد مثبتی در کشت مدفوع نداشتند،‌ در تست PCR مثبت بودند و بقیه موارد مثبت از 24 گله‌ای بود که حد اقل 1 مورد کشت مثبت مدفوع داشتند. ولی در 7 گله که حداقل یک مورد کشت مثبت داشتند، جواب PCR شیر منفی بوده است. همچنین 79% گله‏هایی که حداقل سه رأس گاو الایزا مثبت داشته‏اند، کشت شیر مخزن مثبت داشته‏اند. این درصد در گله‏هایی که یک یا دو رأس گاو الایزا مثبت داشته‏اند، برابر با 49% است.  این محققان بر این نکته تأکید داشته‏اند که حتی در گله‏های الایزا مثبتی که کشت مدفوع گاوها منفی می‏باشد، امکان آلودگی شیر به باکتری Map وجود دارد (26).

در مطالعه Pillai و همکارش از دانشگاه پنسیلوانیای آمریکا نشان داده شد که اگر میزان آلودگی به باکتری در نمونه‌ها بالا و در حد 100 CFU/ml باشد، حساسیت IS900 PCR کامل و 100٪ است. در صورتی که اگر میزان آلودگی به باکتری در نمونه‌ها پایین و در حد 10 CFU/ml باشد، حساسیت پایین­تر و در حد 50٪ است. در قسمت دوم از این تحقیق، شیر 211 رأس گاو به­وسیله کشت و PCR بررسی شد. در کشت 9 نمونه مثبت (4٪) ولی در PCR 69 نمونه  (33٪) مثبت بودند. در قسمت سوم از این کار تحقیقی، تعداد 20 نمونه شیر مخزن، از 20 واحد مورد بررسی قرار گرفت که در از میان آنها 10 نمونه با PCR مثبت بود و تنها یک نمونه با کشت مثبت شد. در مجموع، این محققان حساسیت تست PCR را بیشتر از کشت ارزیابی کرده‏اند. به علاوه میزان آلودگی را در مثبت شدن نتایج دخیل دانسته‎‏اند (18).

در یک مطالعه گسترده که در سال 2001 و در کشور سوئیس انجام گردیده است، که از 1384 گله در مناطق مختلف سوئیس نمونه­گیری شیر مخزن انجام شده و به­وسیله IS900 Nested-PCR بررسی به عمل آمده، مشخص گردید که 273 گله (7/19٪) از نظر وجود باکتری Map در شیرشان مثبت هستند. میزان شیوع در مناطق مختلف سوئیس، تفاوت فاحشی از 7/1٪ تا 2/49 ٪، نشان می‌دهد (10).

Eamens و همکارانش از استرالیا پنج متد مختلف کشت مدفوع را مورد مقایسه قرار دادند و از این بین، ابتدا روشی که در آن آلوده­زدایی با محلول HPC با غلظت 9/0% و کشت در محیط رادیومتریک BACTEC صورت می‏پذیرد، بیشترین حساسیت را دارا بود. بعد از آن روشی که در آن از همان محلول HPC با غلظت 9/0% جهت آلوده­زدایی و از محیط HEYM جهت کشت استفاده شده بود، بهترین نتایج را در بر داشت (12).

 در این مطالعه از همین روش آلوده­زدایی و همین محیط کشت استفاده شد. فرمولاسیون ساخت محیط کشت HEYM از دستورالعمل OIE که در دستنامه روش‏های تشخیصی و واکسن آن سازمان ذکر شده، اقتباس گردید (12).

 Ristow و همکارانش از برزیل در سال 2006 به مقایسه سه فرمولاسیون ساخت محیط HEYM پرداختند و اعلام کردند که فرمول پیشنهادی OIE بهترین نتیجه را به دنبال دارد (21). Dundee و همکارانش از دانشگاه کوینز ایرلند، چهار روش مختلف آلوده­زدایی از شیر جهت کشت باکتری MAP را مقایسه نمودند و به این نتیجه رسیدند که استفاده از محلول HPC بهترین نتایج را در بر دارد (11).

در خاتمه نتایج مطالعه ما همانند بسیاری از مطالعات، شیوع بالای این باکتری را در شیر تانک دامداری­های استان تهران نشان می­دهد که این امر اقدامات جدی به منظور کنترل و مبارزه با این عامل را طلب می­نماید.

  1. حسنی طباطبایی، ع. و فیروزی، ر. 1380. بیماری­های باکتریایی دام. چاپ اول، انتشارات دانشگاه تهران، صفحات: 425-398.
  2. شاه حسینی، م.ح. و سید رضای تهرانی، م . 1384. واکنش زنجیره­ای پلیمراز. چاپ اول، انتشارات  دانشگاه آزاد اسلامی واحد اسلامشهر- شهریار/ شهرقدس،  صفحه: 165.
  3. کریمی، م. و زینلی، س. 1383. PCR مبانی و کاربردهای آزمایشگاهی. (ترجمه)، تالیف: مکفرسون، ام. ج. مولر، اس. جی. چاپ اول، انتشارات اندیشه ظهور، صفحات: 118- 1.
  4. Abbas, B. and Riemann, H.P. 1983. Diagnosis of Johne’s disease (paratuberculosis) in northern California cattle and a note on its economic significance. Calif. Vet. 37: 16.
  5. Abbas, B., Riemann, H.P. and Lonnerdal, B. 1983. Isolation of specific peptides from Mycobacterium paratuberculosis protoplasm and their use in enzyme-linked immunosorbent assay for the detection of paratuberculosis (Johne’s disease) in cattle. Am. J. Vet. Res. 44: 2229-2236.
  6. Benedictus, G., Dijkhuizen, A.A. and Stelwagen, J. 1987. Economic losses due to paratuberculosis in dairy cattle. Vet. Rec. 121: 142-146.
  7. Buergelt, C.D., Williams, J.E. 2004.  Nested PCR on blood and milk for the detection of Mycobacterium avium subsp paratuberculosis DNA in clinical and subclinical bovine paratuberculosis. Australian Veterinary Journal. 82(8): 497-503.
  8. Chiodini, R.J., Van Kruiningen, H.J. and Merkal, R.S. 1984. Ruminant paratuberculosis (Johne’s disease): The current status and future prospects. Cornell Vet. 74: 218-262.
  9. Collins, M.T., and Sockett, D.C. 1993. Accuracy and economics of the USDA-licensed enzyme-linked immunosorbent assay for bovine paratuberculosis. JAVMA. 203: 1456-1463.
  10. Corti, S. and Stephan, R. 2002. Detection of Mycobacterium avium subspecies paratuberculosis specific IS900 insertion sequences in bulk-tank milk samples obtained from different regions throughout Switzerland. BMC Microbiology. 2: 2-7.
  11. Dundee, L., Grant, I.R., Ball, H.J. and Rowe, M.T. 2001. Comparative evaluation of four decontamination protocols for the isolation of Mycobacterium avium subsp. paratuberculosis from milk. Letters in Applied Microbiology. 33:173-177.
  12. Eamens, G.J., Whittington, R.J., Marsh, I.B., Turner, M.J., Saunders, V., et al. 2000. Comparative sensitivity of various faecal culture methods and ELISA in dairy cattle herds with endemic Johne's disease. Veterinary Microbiology. 77: 357-367.
  13. Haghkhah, M., Ansari-Lari, M., Novin-Baheran, A.M. and Bahramy, A. 2008. Herd-level prevalence of Mycobacterium avium subspecies paratuberculosis by bulk-tank milk PCR in Fars province (southern Iran) dairy herds. Preventive Veterinary Medicine. 86:8-13.
  14. Johnson-Ifearulundu, Y.J. and Kaneene, J.B. 1997. Epidemiology and economic impact of subclinical Johne’s disease: A review. Vet. Bull. 67: 437-447.
  15. Johnson-Ifearulundu, Kaneene, Y.J., Sprecher, J.B., Gardiner, D.J. and Lloyd, J.W. 2000. The effect of subclinical Mycobacterium paratuberculosis infection on days opens in Michigan, USA, Dairy Cows. Preventive Veterinary Medicine. 46: 171-181.
  16. Nielsen, S.S., Thamsborg, S.M., Houe, H. and Bitsch, V. 2000. Bulk-tank milk ELISA antibodies for estimating the prevalence of paratuberculosis in Danish dairy herds. Preventive Veterinary Medicine. 44: 1-7.
  17. Ott, S.L., Wells, S.J. and Wagner, B.A. 1999. Herd-level economic losses associated with Johne’s disease on US dairy operations. Prev. Vet. Med. 40:179-192.
  18. Pillai, S.R. and Jayarao, B.M. 2002. Application of IS900 PCR for detection of Mycobacterium avium subsp. paratuberculosis directly from raw milk. American Dairy Science Association. 85:1052-1057.
  19. Quinn, P.J., Markey, B.K., Carter, M.E. and Donnelly, W.J.C. 2002. Veterinary microbiology and microbial disease. Blackwell Sience Ltd. U.S.A., First Edition. p: 97-105. 
  20. Radostits, O.M., Gay, C.C., Hinchcliff, K.W. and Constable, P.D. 2007. Vetrinary medicine, a textbook of the disease of cattle, horses, sheep, pigs and goats. Saunders, Philadelphia, Tenth Edition. p: 1017-1044.
  21. Ristow, P., Silva, M.G., Fonseca, L.S. and Lilenbaum, W. 2006. Evaluation of Mycobacterium avium subsp. paratuberculosis faecal culture protocols and media. Pesq. Vet. Bras. 26(1): 1-4.
  22. Sharma, G., Singh, S.V., Sevilla, I., Singh, A.V., Whittington, R.J. and Juste, R.A. 2008. Evaluation of indigenous milk ELISA with m-culture and m-PCR for the diagnosis of Bovine Johne’s disease (BJD) in lactating Indian dairy cattle. Research in Veterinary Science. 84: 30-37.
  23. Smith, B.P. 2009. Large animal internal medicine. Mosby Elsevier, USA, Forth Edition. p: 881-887.
  24. Sockett, D.C., Conrad, T.A., Thomas, C.B. and Collins, M.T. 1992. Evaluation of four serological tests for bovine paratuberculosis. J. Clin. Microbiol. 30: 1134-1139.
  25. Stabel, J.R. 1996. An improved method for cultivation of Mycobacterium paratuberculosis from bovine fecal samples and comparison to three other methods. J. Vet. Diagn. Invest. 9: 375-380.
  26. Stabel, J.R., Wells, S.J. and Wagner, B.A. 2002. Relationships between fecal culture, ELISA, and bulk tank milk test results for Johne’s disease in US dairy herds. American Dairy Science Association. 85: 525-531.
  27. Sweeney, R.W., Whitlock, R.H., Buckley, C.L. and Spencer, P.A. 1995. Evaluation of a commercial enzyme-linked immunosorbent assay for the diagnosis of paratuberculosis in dairy cattle. J. Vet. Diagn. Invest. 7: 488-493.
  28. Sweeney, R.W., Whitlock, R.H. and Rosenberger, A.E. 1992. Mycobacterium paratuberculosis cultured from milk and supramammary lymph nodes of infected asymptomatic cows. J. Clin. Microbiol. 30: 166-171.
  29. Taylor, J.H. 2000. Mycobacterium avium subspecies paratuberculosis in the causation of Crohn’s disease. World Journal of Gastroenterology. 6(5): 630-632.
  30. Taylor, J.H. and Bull, T. 2002. Crohn's disease caused by Mycobacterium avium subspecies paratuberculosis- a public health tragedy whose resoution is long overdue. J. Med. Microbial. 51: 3-6.
  31. Taylor, J.H. and El-Zaatari, F.A.K. 2004. The Mycobacterium avium subspecies paratuberculosis problem and its relation to the causation of Crohn disease. IWA Publishing, London, UK. p: 74-95.