شناسایی تیپ 91/4 ویروس برونشیت عفونی در جوجه‌های گوشتی استان چهارمحال و بختیاری

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی، واحد شهرکرد، دانشکده دامپزشکی، بخش بیماری‌های طیور، شهرکرد، ایران

2 موسسه واکسن و سرم سازی رازی، بخش بیماری‌های طیور، کرج، ایران

3 دانشگاه آزاد اسلامی، واحد شهرکرد، دانشکده علوم پایه، گروه میکروب شناسی، شهرکرد، ایران

چکیده

بیماری برونشیت عفونی یک بیماری ویروسی واگیردار تنفسی است که عامل بیماری واجد سروتیپ­های متعددی است. در این بررسی به شناسایی تیپ 91/4 (793/B) برونشیت عفونی در استان چهارمحال و بختیاری پرداخته شده است. به این منظور از 18 گله جوجه گوشتی واجد سندرم تنفسی مشکوک به برونشیت عفونی با تلفات بیش از یک درصد در روز نمونه نای اخذ شد. پس از استخراج  RNA از نمونه­های بافتی نای، در واکنش RT-PCR یک مرحله­ای قطعه­ای از ژن S1 ویروس برونشیت عفونی تکثیر شد و محصول RT-PCR با پرایمرهای اختصاصی تیپ91/4 به روش Nested-PCR تکثیر شد. نتایج نشان داد از 18 گله مبتلا به مشکلات تنفسی 11 گله یا به­عبارتی 11/61% آلوده به ویروس برونشیت عفونی بودند که در گله­های مبتلا به برونشیت عفونی، 45/45% آلودگی با تیپ 91/4 را نشان دادند. لذا به نظر می­رسد تیپ 91/4 برونشیت عفونی در شکل­گیری و پیچیده سازی علایم تنفسی در
جوجه­های گوشتی مبتلا به سندرم تنفسی در استان چهارمحال و بختیاری نقش داشته باشد و لازم است سیاست­های کنترلی مناسب در جهت پیشگیری از آلودگی با تیپ 91/4 برونشیت عفونی اتخاذ گردد.

کلیدواژه‌ها


عنوان مقاله [English]

Detection of Infectious Bronchitis Virus (4/91 type) in Broiler Chickens in Chahrmahal-va-bakhtiyari Province

نویسندگان [English]

  • M Gholami-Ahangaran 1
  • A.M Shoushtari 2
  • A Doosti 3
  • E.A Fathi Hafshejani 1
  • N Zia-Jahromi 3
1 Department of Poultry Diseases, Faculty of Veterinary Medicine, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
2 Poultry Diseases Department, Razi Vaccine & Serum Research Institute, Karaj, Iran
3 Department of Microbiology, Faculty of Basic Sciences, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran
چکیده [English]

Infectious bronchitis (IB) disease is a viral contagious respiratory disease. The causing agent of this disease has several serotypes. In this study, 4/91 type of Infectious bronchitis (IB) was identified. For this, tracheal samples were taken from 18 broiler chickens flocks having respiratory signs suspected to IB disease with one percent mortality in day. After RNA extraction from tissue samples in one step RT-PCR reaction, a fragment of S1 gene was amplified by common primers for all IB viruses. Then RT-PCR product was amplified for identification of 4/91(793/B) type by type specific primers in Nested-PCR. Results showed, 11 out 18 flocks (61.1%) were infected to IB that 45.45% of IB infected flocks were infected to 4/91 type. Therefore it seems 4/91 type of IB has role in forming and complexing of respiratory signs in broiler chickens suffering to respiratory syndrome in Chahrmahal-va-bakhtiyari province and it is necessary to give a suitable controlling strategy for prevention of 4/91 infection.

کلیدواژه‌ها [English]

  • broiler chicken
  • Infectious Bronchitis
  • 4/91 (793/B)
  • PCR
  • Chahrmahal-va-bakhtiyari province

مقدمه

 

     بیماری برونشیت عفونی ماکیان یک بیماری ویروسی تنفسی است که از تمام کشورها گزارش شده است. این بیماری از لحاظ اقتصادی به دلیل هزینه­های مرتبط با رخداد تلفات، دارو درمانی و حذف لاشه در کشتارگاه واجد اهمیت است. ویروس عامل بیماری از خانوادة کروناویریده و متعلق به گروه 3 کروناویروس­ها می­باشد. این ویروس دارای 3 پروتئین اصلی شامل گلیکوپروتئین­های خاری (S)، غشایی (M) و پروتئین داخلی نوکلئوکپسید می­باشد. پروتئین Sدارای دو تحت واحدS1  وS2  است. گلیکوپپتیدهای S1مسئول القای آنتی بادی­های ممانعت کننده از هماگلوتیناسیون و آنتی بادی­های خنثی کننده ویروس و تنوع سروتیپی می­باشند و تنها تغییر چند اسید آمینه در قسمت  S1  ویروس می­تواند منجر به ایجاد یک سروتیپ جدید شود (8).  از آنجایی که ویروس عامل برونشیت عفونی شدیداً مستعد تغییرات آنتی ژنی و ژنتیکی می­باشد و از طرفی ایمنی علیه هر سروتیپ کاملاً اختصاصی است و درجة حفاظت متقابل بین سویه­ها با افزایش تفاوت توالی S1 کاهش پیدا
می­کند (8 و2) بنابراین شناسایی و بررسی دوره­ای سروتیپ­های موجود در منطقه در جهت استفاده از واکسن­های حاوی سروتیپ­های موجود در منطقه یک گام مهم در راستای پیشگیری از این بیماری می­باشد.

هدف از این بررسی، شناسایی مولکولی ویروس­های برونشیت عفونی در استان چهارمحال و بختیاری است تا با تعیین تیپ جدایه­های ویروس برونشیت عفونی یک راهبرد مناسب واکسیناسیون هم تراز با سروتیپ­های موجود در استان اتخاذ شود.

مواد و روش­ها

نمونه گیری

در این بررسی از 18 گله جوجه گوشتی مبتلا به سندرم تنفسی از نقاط مختلف استان چهارمحال و بختیاری، با اخذ تاریخچه، نمونه بافتی نای تهیه شد. گله­های واجد سندرم تنفسی دارای علایمی همچون عطسه، سرفه، رالهای تنفسی و آبریزش از چشم و بینی به همراه انسداد مجاری تنفسی و تورم سینوس­ها بودند. تمام گله­های نمونه­گیری شده واجد تلفات بالای یک درصد در روز و فاقد برنامه واکسیناسیون علیه سویه 91/4 برونشیت عفونی بودند. 

شناسایی ویروس 91/4 برونشیت عفونی در گله­های واجد علایم تنفسی بر اساس آزمون PCR بر روی نمونه­های بافتی نای انجام شد.RNA  ویروسی از نمونه نای با کیت تخلیص RNA(High Pure Viral Nucleic Acid Kit، ساخت شرکت Roche) استخراج شد.

واکنش RT-PCR با استفاده از سیستم RT-PCR یک مرحله­ای TITAN (ساخت شرکت Roche) و پرایمرهای XCE2- (5) و S1Uni2+(6) (جدول 1) انجام شد. پرایمرهای مذکور قطعاتی به­طول 1200 جفت بازی از ژن S1 که برای ویروس­های برونشیت عفونی مشترک است، تکثیر
می­کنند.

واکنش RT-PCR با استفاده از بافر واکنش  RT-PCR(همراه با کلرید منیزیم)10 میکرولیتر، محلول DTT 5/2 میکرولیتر،dNTP  ها1 میکرولیتر، پرایمر جلو بر 2 میکرولیتر، پرایمر عقب بر 2 میکرولیتر، مخلوط آنزیمی1 میکرولیتر،RNA  الگو4 میکرولیتر، آب دوبار تقطیر استریل 5/27 میکرولیتر در حجم نهایی50 میکرولیتر انجام شد.

واکنش RT-PCR به­صورت انجام واکنش نسخه برداری معکوس RNA و سنتز cDNA در دمای 45 درجه سانتی­گراد به­مدت 45 دقیقه، واسرشت سازی اولیه ‍cDNA در دمای 94 درجه سانتی­گراد به­مدت 2 دقیقه، واسرشت سازی ‍cDNA در دمای 94 درجه سانتی­گراد به­مدت 30 ثانیه، همسرشت سازی در دمای 48 درجه سانتی­گراد به­مدت 2 دقیقه، گسترش در دمای 68 درجه سانتی­گراد به­مدت 2 دقیقه و گسترش نهایی در دمای 68 درجه سانتی­گراد به­مدت 10 دقیقه انجام شد. در این بررسی مرحله واسرشت سازی، همسرشت سازی و گسترش 35 سیکل تکرار شد (2).

در مرحله بعدی جهت شناسایی تیپ 91/4 برونشیت عفونی از محصول PCR مرحله اول استفاده شد و با تکنیک PCR Nested(PCR آشیانه­ای) قطعه اختصاصی تکثیر شد. بدین منظور از رقت یک دهم محصول RT-PCR در PCR آشیانه ای اختصاصی سروتیپ (793/B)4/91 استفاده شد. در واکنش PCR آشیانه­ای از پرایمر عمومی XCE3- و پرایمر اختصاصی B1+  برای تیپ 4/91(793/B) استفاده شد و قطعه­ای به طول 975 جفت بازی تکثیر شد (4) (جدول 1).

 

 

 

جدول1- اختصاصات پرایمرهای مورد استفاده در واکنش RT-PCR و PCR آشیانه­ای

 

نوع واکنش

نام پرایمر

توالی

موقعیت در ژن S1

ویژگی

منبع

RT-PCR

S1Uni2+

5'CCCAATTTGAAAACTGAACA3'

47-31

 

(6)

XCE2-

5'CCTCTATAAACACCCTTGCA3'

1193-1170

 

(4)

Nested-PCR

XCE3-

5'CAGATTGCTTACAACCACC3'

1111-1093

 

(4)

B1+

5'AAGTGCCTTTAGGCCTGG3'

110-93

4/91

(4)

 

 

واکنش PCR آشیانه­ای با استفاده از بافر (همراه با کلرید منیزیم) 5 میکرولیتر،dNTP ها 1 میکرولیتر، پرایمرها 4 میکرولیتر، آنزیم Taq پلیمراز 1 میکرولیتر، DNA الگو (محصول RT-PCR)4 میکرولیتر، آب دوبار تقطیر استریل 37 میکرولیتر در حجم نهایی50 میکرولیتر انجام شد.

واکنش PCR آشیانه­ای به­صورت واسرشت سازی اولیه ‍DNA در دمای 94 درجه سانتی­گراد به­مدت 3 دقیقه، واسرشت سازی ‍DNA در دمای 94 درجه سانتی­گراد به­مدت 1 دقیقه، همسرشت سازی در دمای 48 درجه سانتی­گراد به­مدت 2 دقیقه، گسترش در دمای 72 درجه سانتی­گراد به­مدت 90 ثانیه و گسترش نهایی در دمای 72 درجه سانتی­گراد به­مدت 10 دقیقه انجام شد. مرحله واسرشت سازی، همسرشت سازی و گسترش 35 سیکل تکرار شد.

در این بررسی از مارکر 100 جفت بازی ساخت شرکت فرمنتاز (Fermentase) استفاده شد و محصول تکثیر شدة نهایی به روش الکتروفورز در ژل آگارز 1% رنگ شده با اتیدیوم بروماید، با تابش اشعه UV مشاهده و مورد آنالیز قرار گرفت.

در این بررسی از واکسن 91/4 (Nobilis IB 4/91, Intervet International B.V.) به عنوان کنترل مثبت و آب مقطر استریل به عنوان کنترل منفی استفاده شد.

 

 

یافته­ها

   شناسایی ویروس برونشیت عفونی

واکنش RT-PCR و PCR آشیانه­ای

در واکنش RT-PCR با پرایمر عمومی برونشیت عفونی، قطعه­ای از ژن S1 به طول 1200 جفت بازی مورد تکثیر قرار گرفت. از 18 گله دارای علایم تنفسی مشکوک به برونشیت عفونی، نمونه­های متعلق به 11 گله مانند سویه­های رفرانس (کنترل مثبت) قطعه 1200 جفت بازی تکثیر کردند (نگاره 1). بنابراین از مجموع 18 گله مورد بررسی، 11 گله آلوده به ویروس برونشیت عفونی می­باشد.

در واکنش PCR آشیانه­ای، سویه رفرانس تیپ 91/4 قطعه­ای به طول 975 جفت بازی تولید کرد (نگاره 1). 5 جدایه چهارمحال و بختیاری درPCR آشیانه­ای، باند 975 جفت بازی تولید کردند. بنابراین 5 جدایه متعلق به تیپ 91/4 می­باشند.

 

 

 

نگاره 1- الکتروفورز سویه­های رفرانس

ستون 1: مارکر 100 جفت بازی

ستون2: نمونه مثبت ویروس برونشیت عفونی با محصول 1200 جفت بازی

ستون3: سویه رفرانس 91/4 با محصول  975 جفت بازی

بحث و نتیجه­گیری

    استفاده از  RT-PCR به همراه  PCRآشیانه­ای، یک ابزار تشخیصی برای ویروس برونشیت عفونی است که ضمن حساسیت بالاتر نسبت به جداسازی ویروس از طریق تخم مرغ جنین­دار و شناسایی سریع ویروس برونشیت عفونی (12)، سروتیپ­های مختلف این ویروس با روش PCR آشیانه­ای قابل تفریق می­باشد (10). از آنجایی­که تحت واحد S1 ویروس برونشیت عفونی دارای اپی­توپهای اختصاصی سروتیپ است (8) لذا در این بررسی مبنای شناسایی ویروس در روش RT-PCR و PCR آشیانه­ای، تکثیر قسمتی از ژن S1 ویروس برونشیت عفونی در نظر گرفته شد و با پرایمرهای اختصاصی تیپ، به شناسایی تیپ 91/4 پرداخته شد. در بررسی اخیر، از 11 سویه برونشیت عفونی در استان چهارمحال و بختیاری، 5 جدایه متعلق به تیپ 91/4 می­باشد. با توجه به اینکه گله­های مورد بررسی در طول دورة پرورش از واکسن 91/4 استفاده نکرده­اند لذا این مطالعه نشان می­دهد تیپ 91/4 در استان چهارمحال و بختیاری وجود دارد.

بررسی وضعیت بیماری برونشیت عفونی در ایران به گزارش آقاخان و همکاران در سال 1994 برمی­گردد. بررسی جدایه­های فیلدی توسط ایشان مؤید وجود سروتیپ ماساچوست به عنوان تنها سروتیپ ویروس برونشیت عفونی ایران بوده است (5). وجود بیماری برونشیت در بسیاری از گله­های ماکیان با مشکلات تنفسی علیرغم واکسیناسیون با سویه H120 این احتمال را تقویت کرد که ممکن است سروتیپ یا سروتیپ­های دیگر این ویروس، باعث رخدادهای جدید این بیماری شده باشد. اما حضور سویه 91/4 در ایران به گزارش وصفی مرندی و بزرگمهری فرد، در مورد یک واریانت جدید برونشیت عفونی در گله­های طیور (14) ایران در سال 1377 (1998) برمی­گردد که با بررسی­های مولکولی و تعیین توالی مشخص شد این واریانت متعلق به تیپ91/4 می­باشد (1). علاوه براین، گزارشاتی از حضور تیپ 91/4 در استان خوزستان (13)، فارس (11) و اصفهان (2) وجود دارد.

اگرچه چالش تجربی با این ویروس نشان دهنده بیماری­زایی تیپ 91/4 می­باشد (9) و این عامل ویروسی به عنوان یکی از عوامل تنفسی درگله­های طیور مطرح است (1) اما در مطالعه اخیر بیماری­زایی این ویروس در فارم­های مورد بررسی مورد مطالعه قرار نگرفته است که نیاز به مطالعات تکمیلی دارد. به هرحال با آشکار شدن حضور تیپ 91/4 در استان چهارمحال و بختیاری و گزارشات قبلی مبنی بر حضور یک واریانت برونشیت عفونی (14) و در مواردی اثبات حضور ویروس 91/4 در نقاط دیگر ایران (2، 13 و 11) به­نظر می­رسد با ورود این ویروس به ایران در نقاط مختلف کشور پراکنده شده است.

در اکثر بررسی­ها جداسازی سویه 91/4 در اواخر دوره پرورش جوجه گوشتی و در حدود  8-6 هفتگی گزارش شده است (3، 9 و 10) اما گزارشاتی نیز وجود دارد که نشان می­دهد امکان آلودگی با سویه 91/4 در گله­های گوشتی غیرایمن (غیر واکسینه)، در سنین پایین­تر وجود دارد (7). در بررسی اخیر، با شناسایی سویه 91/4 در جوجه­های گوشتی 21 و 25 روزه، احتمال آلودگی با این سویه در سن پایین تقویت می­گردد.

به طور کلی، این بررسی نشان داد شیوع ویروس برونشیت عفونی محصوصاً تیپ 91/4 برونشیت عفونی در فارم­های جوجه گوشتی استان چهارمحال و بختیاری به­عنوان یکی از استان­های واقع در نواحی غرب ایران بالاست. لذا در مرحله اول لازم است بیماری­زایی این ویروس در فارم­های پرورشی طیور بررسی شود و در مرحله بعد سیاست­های کنترلی مناسب جهت پیشگیری از این بیماری اتخاذ شود.

  1. اکبری آزاد، گ.، وصفی مرندی، م. و کیوانی، ح. (1383): جداسازی و شناسایی مولکولی ویروس­های برونشیت عفونی طیور در مرغداریهای صنعتی ایران. مجله دانشکده دامپزشکی دانشگاه تهران، 59(3): صفحات: 264-259.
  2. غلامی آهنگران، م.، چرخکار، س.، شوشتری ع.، بزرگمهری فرد م.ح.، و عشرت آبادی ف. (1387): شناسایی مولکولی و تعیین تیپ ویروس برونشیت عفونی در موارد سندرم تنفسی جوجه­های گوشتی در استان اصفهان. مجله علوم دامپزشکی ایران، 5 (3): صفحات: 476-469.
  3. Adzhar, A.B., Show, K.B., Britton, P., and Cavanagh, D. (1995): Avian infectious bronchitis virus: differences between 793/B and other strains. Veterinary Record. 136(27):548.
  4. Adzhar, A., Gough, R.E., Haydon, D., Shaw, K., Britton, P., and Cavanagh, D. (1997): Molecular analysis of the 793/B serotype of infectious bronchitis virus in Great Britain. Avian Pathology. 26:625-640.
  5. Aghakhan, S.M., Abshar, N., Rasoul Nejad Fereidouni, S., Marunesi, C., and Khodashenas, M. (1994): Studies on avian viral infections in Iran. Archive del Institut Razi. 44/45:1-10.
  6. Binns, M.M., Boursnell, M.E.G., Cavanagh, D., Pappin, D.J.C., and Brown, T.D.K. (1985): Cloning and sequencing of the gene encoding the spike protein of the coronavirus IBV. Journal of General Virology. 66:719-726.
  7. Cavanagh, D., Mawditt, K., Britton, P., and Naylor, C.J. (1999): Longitudinal field studies of infectious bronchitis virus and avian pneumovirus in broiler using type specific polymerase chain reaction. Avian Pathology. 28:593-605.
  8. Cavanagh, D. and  Gelb, J. Infectious bronchitis. In: Saif, Y.M. Fadly, A.M. Glisson, J.R. McDougald, L.R. and Nolan, L.K. Swayne, D.E. (2008): Diseases of Poultry. 12th ed. Blackwell Publishing, Iowa State University Press, USA, Ames, pp: 117-135.
  9. Mahdavi, S., Tavasoly, A., Pourbakhsh, S.A., Momayez, R. (2007): Experimental histopathologic study of the lesions induced by serotype 793/B (4/91) infectious bronchitis virus. Archives of Razi Institute, 62(2): 15-22.
  10. Meulemans, G., Boschmans, M., Decaesstecker, M., van den Berg, T.P., Denis, P., and Cavanagh, D. (2001): Epidemiology of infectious bronchitis virus in Belgian broilers: a retrospective study1986-1995. Avian Pathology. 30:411-421.
  11. Nouri, A., Assasi, K., and Seify-abad Shapouri, M.R. (2003): Field study of infectious bronchitis virus in broiler using type-spscific RT-PCR. Archives of Razi Institute. 55:1-10.
  12. Ramneek, R., Mitchel, N.L., and Mcfarlane, R.G. (2005): Rapid detection and charecterisation of IBV from New Zealand using RT-PCR and sequence analysis. New Zealand Veterinary Journal. 53(6):457-461.
  13. Seify-abad Shapouri, M.R., Mayahi, M., Charkhkar, S., and Assasi, K. (2002): Serotype identification of recent Iranian isolates of infectious bronchitis virus by type specific multiplex RT-PCR. Archives of Razi Institute. 53:79-85.
  14. Vasfi Marandi, M., and Bozorgmehri Fard, M.H. (2000): Isolation and identification of infectious bronchitis virus in chicken in Iran. Proceeding of the 21st World,s Poultry Congress, Aug:20-25, Montreal, Canada.