بررسی وضعیت آلودگی ماده گاوهای هلشتاین پیر به ویروس کمبود ایمنی گاو (BIV) و ارزیابی بالینی آن‌ها در برخی از گاوداری‌های شیری اطراف تبریز

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانشگاه تبریز، استادیار دانشکده دامپزشکی، گروه علوم درمانگاهی، تبریز، ایران

2 دانشگاه تهران، دانشجوی دوره دکترای تخصصی دانشکده دامپزشکی، گروه پاتوبیولوژی، تهران، ایران

3 دانشگاه تبریز، دانشکده دامپزشکی، دانش آموخته دامپزشکی، تبریز، ایران

چکیده

ویروس کمبود ایمنی گاو، لنتی­ویروسی از خانواده بزرگ رتروویروس­ها می­باشد. در امکان ایجاد عوارض عفونی متنوع ناشی از اختلال سیستم ایمنی توسط آن و در نتیجه خسارات اقتصادی حاصله نظرات متفاوتی ارائه شده است. نظر به فراوانی آلودگی با این ویروس در گاوداری­های کشورهای مختلف و ارتباط این آلودگی­ها با وقوع اختلالات بالینی، انجام مطالعات بسیار اندک در ایران و همچنین احتمال همبستگی میزان آلودگی با افزایش سن و در نتیجه پیشنهاد وازد نمودن گاوهای پیر به ظاهر سالم، این تحقیق با هدف تعیین وضعیت آلودگی با این ویروس و بررسی اختلالات بالینی در گاوهای هلشتاین مسن در برخی از گاوداری­های اطراف تبریز به اجرا در آمد. در این مطالعه به برخی گاوداری­های شیری اعم از سنتی یا صنعتی و عمدتاً واحدهای کوچک اطراف تبریز مراجعه شد. 50 رأس گاو شیری هلشتاین به ظاهر سالم با سن بالاتر از 6 سال انتخاب و مشخصات انفرادی و بالینی آنها ثبت گردید. از دام های مورد مطالعه نمونه­های خون جهت ردیابی ژنوم BIV  تهیه شد. نتایج واکنش زنجیره­ای پلی­مراز از نوع نستد، روی نمونه­ها نشان دادند که آلودگی با ویروس کمبود ایمنی گاو در گاوهای مورد مطالعه، به میزان 2 درصد (یک رأس از 50 مورد) وجود دارد. بین میزان آلودگی به این ویروس و سن رابطه­ آماری
معنی­داری مشاهده نشد. همچنین بین میزان آلودگی و درجه وضعیت بدنی، میزان تولید شیر، وجود اختلالات بالینی، وجود سابقه­ اختلالات بالینی، حالت ظاهری عقده­های لنفاوی، حضور یا بزرگ شدگی عقده ­های خونی رابطه آماری معنی­داری مشاهده نشد. بررسی حاضر نشان داد که گاوهای هلشتاین نمونه­برداری شده واجد آلودگی بسیار پائینی با ویروس BIV هستند و برخلاف برخی مطالعات گذشته و مطابق با برخی دیگر، افزایش سن تاثیری در حساسیت به آلودگی با این ویروس ندارد. کوچک کردن واحدهای گاوداری و کاهش تراکم گاو در آنها، می­تواند در پیشگیری و کنترل آلودگی با BIV کمک­کننده باشد.

کلیدواژه‌ها


عنوان مقاله [English]

A survey on the status of BIV-infection and associated clinical findings in old- age Holstein cattle of some dairy farms aruond of Tabriz

نویسندگان [English]

  • mohammad tooloei 1
  • samad farrashi 2
  • hamed panahpour 3
چکیده [English]

Bovine immunodeficiency virus is a Lentivirus from the large family of retroviridae. Different opinions have been submitted about the possibility of varieties of infectious complications due to Bovine immunodeficiency virus and induced losses to dairy industry. Considering the worldwide distribution of the BIV infection in cattle herds and correlation of the infection with different kinds of clinical disorders and consequent severe economic losses to dairy cattle industry and the fact that only few surveys about the status of the BIV infection have been performed in Iran as well as the probability of increasing infection rate with aging and therefore increasing the culling rate, this study was done to identify the BIV infection rate in aged Holstein cattle and evaluation of their associated clinical disorders in some dairy herds around Tabriz. In this study which was performed in some industrial or traditional especially the small dairy farms around Tabriz, 50 Holstein dairy cattle with the age of higher than 6 years old were selected and their clinical characteristics recorded. Blood samples were taken to detect BIV genome. According to the results of the Nested-PCR method in this study, 2% (1/50) of the aged cattle were infected with BIV. There wasn’t any significant correlation between BIV infection rate and age. Also there weren’t any significant correlations between BIV infection rate and BCS, milk production rate, any clinical problems, enlarged lymph nodes and haemal nodes. The results showed that the BIV infection rate among the aged cattle was relatively low and in contrast to some other studies, aging does not affect the sensitivity to infection. Decreasing the population in the livestock units and farms, could be helpful in prevention and control of BIV infection in cattle.
  

کلیدواژه‌ها [English]

  • Bovine immunodeficiency virus
  • Holstein cattle
  • PCR
  • age
  • Tabriz

مقدمه

 

     ویروس کمبود ایمنی گاو (Bovine Immunodeficiency Virus) از اعضای گروه
لنتی ­ویروس­ها متعلق به خانواده بزرگ رتروویروس­ها می­باشد (Avidan and Hizi, 2008). BIV اولین بار در سال 1969 از یک گاو ماده 8 ساله با وضعیت بدنی ضعیف در لوئیزیانا ایالات متحده آمریکا جدا شد (جدایه R29) و توسطVan der Maaten و همکاران، در سال 1972 گزارش گردید. جدایه­های FL112 و FL491 این ویروس نیز از فلوریدا گزارش شده است (Surarez et al., 1993). گوساله، گوسفند، بز و خرگوش به­صورت تجربی به این ویروس آلوده شده­ و سرم مثبت شده­اند (Baron et al., 1998; Hirai et al., 1995 Walder et al., 2001;) ولی آلودگی طبیعی عمدتاً در گاوها بوده است (Walder et al., 2001). تاکنون مدرکی دال بر انتقال این ویروس به انسان وجود ندارد (Andrews et al., 2003; Gradil et al., 1999; Radostitis et al., 2007). فرض بر آن است که BIV، مشابه دیگر لنتی ویروس­ها به­وسیله­ تبادل مایعات بدن منتشر می­شود (Belloc et al., 1996). آلودگی واکسن، سرسوزن­های آلوده، معاینه­ رکتومی انتقال از طریق شیر، لکوسیت­های منی گاوهای نر و انتقال عمودی نیز به­عنوان روش­های محتمل انتقال پیشنهاد شده­اند (Nash et al., 1995; Cary et al., 2002; Meas et al., 2002 b; Scholl et al., 2000 ).

آلودگی با این ویروس در جمعیت گاوهای کشورهای مختلف دنیا از جمله مناطق مختلف ایالات متحده آمریکا (Radostitis et al., 2007; St. Cyr et al., 1994)، استرالیا، اندونزی، نیوزلند (Andrews et al., 2003; Barboni et al., 2001; Radostitis et al., 2007)، کشورهای اروپایی از جمله آلمان، فرانسه (Polack et al., 1996)، هلند (Horzinek et al., 1991) و ایتالیا (Carivani et al., 1998)، کشورهای آسیایی از جمله ژاپن (Meas et al., 2002 b; Usui et al., 2003)، کره (Cho et al., 1999)، پاکستان (Meas et al., 2000 b)، ترکیه (Meas et al., 2003)، روسیه (Kolotvin et al., 2007)، کامبوج (Meas et al., 2000a)، کشورهای آفریقایی (Meas et al., 2004) و آمریکای جنوبی از جمله ونزوئلا ، برزیل (Meas et al., 2002 a) و آرژانتین (Gonzalez et al., 2008) از 1 الی حدود 60% گزارش شده است.

با توجه به شباهت­های BIV با HIV، فرض این موضوع که این ویروس نیز بایستی در گاو اثرات آسیب­زایی مشابهی داشته و سلامتی آنها را به­صورت مزمن، به خطر اندازد، توجیه­پذیر می­باشد اما احتمالاً به علت عمر اقتصادی پائین گاو و دوره کمون بالای ویروس، سندروم­های بالینی و اثرات آسیب­زائی ایجاد شده توسط این ویروس در گاو شناخته نمی­شوند (Carivani et al., 1998; Isaacson et al., 2007). تغییرات پاتولوژیکی متعددی در گاوهای آلوده به BIV شامل اختلال در عملکرد مونوسیت­ها، آنسفالوپاتی، لنفوآدنوپاتی و کمبود ایمنی گزارش کرده­اند (Meas et al., 2001; Meas et al., 2002 b; Everman et al., 2000; Cho et al., 1999). لاغری (Meas et al., 2000 b; Polack et al., 1996; Snider et al., 2003 a; Snider et al., 1996)، کاهش تولید شیر (Meas et al., 2000 a; Snider et al., 2003 a; Usui et al., 2003)، بزرگی عقده­های خونی، لنفادنوپاتی، نشانه­های عصبی، لنگش، آتاکسی، پاراپلزی و طیف وسیعی از بیماری­های ثانویه (Andrews et al., 2003; Snider et al., 2003 a; Snider et al., 2003 b; Snider et al., 1996; Nikbakht et al., 2009) از نشانه­های گزارش شده آلودگی هستند. در مطالعه­ای متداول­ترین یافته پس از کشتار در گاوهای آلوده به این ویروس را درگیری عقده­های لنفاوی بدن دانسته­اند که تبدیل به عقده­های خونی گرد و بزرگ به رنگ سیاه شده و یا در درون خود حاوی این عقده­های خونی می­شوند (Munro et al., 1998). در بررسی دیگر عقده­های خونی بزرگ شده، عمدتاً در ناحیه گردن یا هم در ناحیه گردن و هم در ناحیه تهیگاهی و گاهی پهلوها به­صورت قرینه قابل لمس یا مشاهده بودند (Tagipour Bazargani et al., 2010).

به خاطر مشکل بودن تشخیص دام­های آلوده از طریق جداسازی ویروس و محدودیت­های روش­های سرولوژیک از جمله عدم شناسایی آنتی بادی در مراحل اولیه یا مزمن آلودگی، عمدتاً به طور موفقیت­آمیزی اقدام به شناسایی DNA پروویروسی با به­کارگیری پرایمرهای pol و gag  به روش واکنش زنجیره­ای پلی­مراز به ویژه نوع نستد، در لکوسیت­های خونی، نسوج لنفاوی یا عصبی نموده­اند (Andrews et al., 2003; Gradil et al 1999; Patil et al., 2003; Snider et al., 2003 a; Orr et al., 2003) و به نظر می­رسد که این روش، قابل اعتمادترین و حساس­ترین روش (حساسیت 80% و ویژگی 86%) در تشخیص این ویروس می­باشد (Lew et al., 2004). ویروس می­تواند از   سلول­های تک­هسته­ای خون محیطی، طحال، عقده­های لنفاوی و مغز در طول زندگی حیوانات آلوده جدا شود (Belloc et al., 1996).

در مطالعات محدود صورت گرفته در ایران که عمدتاً در 3 سال اخیر انجام گرفته­اند، میزان آلودگی با این ویروس در گاوهای هلشتاین استان­های مختلف از 5/7% (Tolouei et al., 2010)، 2/16%  (Tagipour Bazargani et al., 2010)، 3/20% (Nikbakht et al., 2009) تا 60% (Tajbakhsh et al., 2010) متغیر بوده است.

تاثیر سن دام­ها در حساسیت به آلودگی با این ویروس، شناسایی شده و در مطالعه­ای روی گاوهای شیری در میسی سیپی نشان داده شد که میزان آلودگی با افزایش سن گاوها افزایش
معنی­داری می­یابد (St Cyr et al., 1994; Tagipour Bazargani et al., 2010). لذا، نظر به آلودگی با این ویروس درگاوداری­های کشورهای مختلف و حتی ایران و ارتباط محتمل این آلودگی­ها با وقوع اختلالات بالینی و با توجه به انجام مطالعات بسیار اندک در ایران و همچنین احتمال همبستگی میزان آلودگی با افزایش سن و در نتیجه پیشنهاد وازد نمودن گاوهای پیر به ظاهر سالم، این تحقیق با هدف تعیین وضعیت آلودگی با این ویروس و بررسی اختلالات بالینی در گاوهای هلشتاین مسن در برخی از گاوداری­های اطراف تبریز به اجرا در آمد.

مواد و روش­ها

    جمعیت دام­های مورد مطالعه، روش نمونه­گیری و ثبت اطلاعات: جمعیت مورد هدف این بررسی، 50 رأس گاو هلشتاین پیر (بالای 6 سال که حداقل 4 زوج دندان بالغ داشته و روندهای فرسایشی در دندان­های آن­ها شروع شده باشد) بودند. برای این منظور، در فاصله­ زمانی اوایل پاییز تا اواخر زمستان سال 1390، با مراجعه به برخی گاوداری­های شیری اعم از سنتی یا صنعتی و عمدتاً واحدهای کوچک اطراف تبریز، اقدام به معاینه و نمونه­گیری از گاوهای پیر گردید. نمونه­های خونی به میزان 5 میلی لیتر از ورید دمی و در لوله­های ونوجکت حاوی ماده ضد انعقاد EDTA (شرکت Vaccute ساخت کشور اتریش) اخذ شدند. برای هر دام، لوله­ ونوجکت و سر­سوزن نو مورد استفاده قرار گرفت. مشخصات دام­های مورد نمونه­برداری از جمله میزان تولید، تعداد شکم زایش، وضعیت بالینی دام شامل درجه وضعیت بدن (BCS)، وضعیت عقده­های لنفاوی و عقده­های خونی، وضعیت اندام­های حرکتی (از لحاظ لنگش)، وضعیت تولید مثلی (اختلالات موجود و سابقه اختلالات)، وضعیت دستگاه گوارش (اختلالات موجود و سابقه­ اختلالات)، تنفس، عصبی، بینایی، پوشش خارجی، پستان­ها و سایر
دستگاه­های بدن مورد ارزیابی قرار گرفته و ثبت شدند.
نمونه­های خون اخذ شده به منظور جستجوی ژنوم ویروس BIV در مجاورت یخ به آزمایشگاه منتقل شدند.

آماده سازی و استخراج DNA: گلبول­های قرمز نمونه­ها با استفاده از محلول بافر A (لیزکننده گلبول­های قرمزحاوی Tris-HCl ،MgCl2، Nacl، Triton x 100) و سلول­های سفید توسط محلول بافرB  (لیز کننده گلبول­های سفید حاوی Tris- HCl، Nacl، EDTA نیم مول، SDS10%) لیز شده و با اضافه نمودن محلول گوانیدیوم 5M و سپس  محلول استات پتاسیم و در نهایت سانتریفوژ نمودن کل مجموعه با 14000rpm، DNA سلولی در مایع رویی آزاد می­شد. بدنبال اضافه نمودن 7/0حجم محلول ایزوپروپانول سرد به مایع رویی و سانتریفیوژ آن، DNA در ته میکروتیوب رسوب کرده و با محلول اتانول شستشو شده و با سانتریفوژ و دور ریختن محلول رویی اتانول، پلیت DNA در هوای تمیز خشک شده و با اضافه نمودن محلول TE روی آن، DNA به­دست آمده جهت استفاده PCR آماده بوده و به فریزر20- درجه سانتی­گرادمنتقل می­شد. به منظور تائید صحت مرحله استخراج DNA، این نمونه­ها با استفاده از پرایمرهای ژن (GAPDH)، PCR شده و نتیجه روی ژل برده شدند تا از حضور این ژن در پروفایل به­عنوان معیار صحت استخراج DNA استفاده شود. ردیف اولیگونوکلئوتیدی پرایمرهای ژن GAPDH شامل:

 F(5'-TGGCAAAGTGGACATCGTCG-3')  و

R (5'-TTGCGTGGACAGTGGTCATAAGTC-3')  بودند.

پرایمرهای اولیگونوکلئوتیدی: برای ردیابی حضور DNA پروویروسی BIV، پرایمرهای ژن gag ویروس، انتخاب شدند (جدول 1).


 

جدول 1- توالی نوکلئوتیدی و موقعیت پرایمرهائی مورد استفاده در آمپلیفیکاسیون قطعه ژن gag ویروس کمبود ایمنی گاو

اندازه محصول (جفت بازbp)

توالی اولیگونوکلئوتید

موقعیت در ژنوم ویروس

ژن

پرایمر

مرحله واکنش

740

5' – AGGCCAGAGCTGATAAGGAA - 3'

673-653

gag

Gag F

PCR  دور اول

5' – ATCCCACTACCCTACATGCT - 3'

 

1393-1373

gag

Gag R

392

5' – AGATCTGGTCAGACGCCA - 3'

5' – CCAAGGAGCCGTACACAG - 3'

839-821

1213-1199

gag

gag

 

Gag 3

Gag 4

 

PCR  دور دوم

 

 

 

 

این پرایمرها مطابق با سکانس BIV سویه NC-001413.1 که در بانک ژنی سایت PubMed بنام سویه رفرانس معرفی شده بودند (Garvey et al., 1990) و با کمک نرم­افزار Fast PCR 5.2، طراحی شدند. تمامی پرایمرهای استفاده شده از شرکت  Prime ایتالیا  تهیه شدند.

آمپلیفیکاسیون DNA پروویروسی: به منظور شناسائی  DNA پروویروسی BIV در ژنوم سلول­های تک­هسته­ای گاوهای مورد مطالعه، با به­کارگیری پرایمرهای اختصاصی، از روش نستد PCR که توسط Nadin-Davis  و همکاران (1993) توضیح داده شده، استفاده شد. به طور خلاصه در این روش، برای شناسائی یک قطعه DNA 329 جفت بازی از سکانس ویروس مذکور مطابق با نوکلئوتید 1213-821 ژن gag، آمپلیفیکاسیون دو مرحله­ای انجام گرفت. در هر سری از واکنش­ها، حداقل یک نمونه کنترل منفی بدون DNA و یک نمونه DNA پلاسمید GAG (PBIV300) حاوی سکانس­های کامل DNA پروویروسی BIV (که از کشور کانادا – اتاوا ازSusan Nadin-Davis دریافت گردید)، به­عنوان کنترل مثبت استفاده می­شد. حجم مخلوط نهائی هر واکنش به 50 میکرولیتر
می­رسید. مواد مورد استفاده و حجم هر کدام از آنها برای
به­دست آوردن مخلوط نهائی عبارت بودند از: 100 نانوگرم (2میکرولیتر) DNA ژنومی سلول­ها (در واکنش مرحله دوم PCR، به جای نمونه DNA، یک میکرولیتر از محلول PCR مرحله اول استفاده می­شد)، 5/38 میکرولیتر آب (در واکنش مرحله دوم، 5/39 میکرولیتر)، 5 میکرولیتر بافرx10 (حاوی Tris-HCl20 mMبا pH=8.8، KCl 50 mM، Triton X100 1/0%)، 5/1میکرولیتر MgCl2 50 mM، 2 میکرولیتر dNTPs 25/1مولار حاوی 5 میلی مول از هر dNTP، 5/0 میکرولیتر از هر پرایمر و 2/0 میکرولیتر (حاوی 5 واحد در هر میکرولیتر) Taq پلی مراز.

چرخه­های حرارتی با استفاده از یک دستگاه ترموسایکلیر Techne مدل Tc 512، به ترتیب زیر انجام گرفت: پس از مرحله واسرشت سازی اولیه در 94 درجه سانتی­گراد به مدت 3 دقیقه، مراحل کامل آمپلیفیکاسیون برای 34 سیکل تکرار شدند، بدین صورت که در تمام سیکل­ها، مرحله اول (واسرشت سازی) و سوم (ساخت رشته مکمل هدف) به ترتیب در 94 درجه سانتی­گراد به مدت 1 دقیقه و 72 درجه سانتی­گراد به مدت 2 دقیقه انجام شده و سپس مرحله نهائی ساخت رشته مکمل با 10 دقیقه  در 72 درجه سانتی­گراد دنبال شدند با این تفاوت که مرحله دوم (چسبیدن پرایمرها به هدف)،  در هر سیکل به مدت 1 دقیقه، در دو سیکل ابتدائی در دمای 60 درجه سانتی­گراد، در دو سیکل بعدی در 5/57 درجه سانتی­گراد و در 30 چرخه آخر در 55 درجه سانتی­گراد انجام گرفت. بدین شکل مرحله اول PCR در 34 چرخه تمام شده و سپس محصول واکنش  PCR مرحله اول، آماده­سازی و رقیق­تر شده و آمپلیفیکاسیون مرحله دوم روی آن، در همان شرایط انجام
می­شد.

شناسائی محصول PCR: محصولات PCR با استفاده از الکتروفورز و جداسازی روی ژل آگارز 1%، با بکارگیری یک دستگاه ترانس لومیناتورUV و رنگ­آمیزی با اتیدیوم بروماید، سپس تصویربرداری مورد ارزیابی قرار گرفتند.

تحلیل آماری: بررسی آماری با استفاده از نرم افزارSPSS 14.5 و بکارگیری آزمون­های فیشر، مک نمار و محاسبه آماری کاپا برای مقایسه نتایج آزمون  PCRبا بزرگ­شدگی عقده­های خونی، مربع کای برای سنجش ارتباط بین متغیرهای سن، حضور اختلال بالینی و درجه وضعیت بدنی با نتایج آلودگی انجام شد. با آزمون کولموگرو- اسمیرنو از نرمال بودن توزیع داده­ها، اطمینان حاصل شد.

یافته­ها

     میزان آلودگی به ویروس کمبود ایمنی گاو: نتایج Nested- PCR روی DNA­ های استخراج شده از سلول­های تک هسته­ای خون محیطی 50 رأس گاو مورد بررسی با استفاده از پرایمرهای ژن gag ویروس کمبود ایمنی نشان داد که در PCR دور اول، هیچ باند آشکاری به­دست نیامد ولی در PCR دور دوم، در 1 نمونه، قطعه bp 392 دیده شد، لذا مورد مذکور واجد DNA پروویروسی کمبود ایمنی گاو بوده که میزان آلودگی گاوهای این مطالعه با این آزمون برابر 2 درصد برآورد شد (نمودار 1).

 

 

نمودار 1: توزیع فراوانی مطلق و نسبی آلودگی به ویروس کمبود ایمنی گاو بر اساس نتایج حاصل از آزمون واکنش زنجیره­ای پلی­مراز در 50 رأس گاو مورد مطالعه

 

تصویر ژل آگاروز چند نمونه از محصولات PCR آمپلیفای شده با پرایمرهای ژن gag ویروس کمبود ایمنی گاو که با اتیدیوم بروماید رنگ­آمیزی شده­اند، در نگاره­های 1 و 2 آمده است. با توجه به پرایمرهای مورد استفاده در این واکنش، باند مورد انتظار برای تشخیص وجود ژنوم ویروس کمبود ایمنی گاو، قطعه­ای به طول bp 392 بود که حضور آن بیانگر اختصاصی بودن باند تکثیر یافته شده در PCR می­باشد.

 

 

 

 

نگاره 1- ژل آگاروز مربوط به الکتروفورز تعدادی از نمونه­های محصولات PCR آمپلیفای شده با پرایمرهای ژن gag ویروس کمبود ایمنی گاو که با اتیدیوم بروماید رنگ­آمیزی شده و با اشعه ماورابنفش تصویر برداری شده­اند: خط 8 مارکر یک کیلوبازی و خطوط 1 و 2  کنترل مثبت را نشان می­دهند. لازم به ذکر است هیچ نمونه­ مثبتی در این ژل آگارز وجود ندارد.

 

 

نگاره 2- ژل آگاروز مربوط به الکتروفورز تعدادی از نمونه­های محصولات PCR آمپلیفای شده با پرایمرهای ژن gag ویروس کمبود ایمنی گاو که با اتیدیوم بروماید رنگ آمیزی شده و با اشعه ماورابنفش تصویر برداری شده­اند: نمونه­ مثبت با حضور باند 392 جفت بازی مشخص شده است (خط 5 ). خط 1 مارکر یک کیلوبازی و خط 2 کنترل مثبت را نشان می­دهند. خط 3 ،4 ، 6 ، 7 ،‌ 8 و 9 نمونه­های منفی را نشان می­دهند.

 

 

 


فراوانی آلودگی در رده­های سنی و مشخصات بدنی و تولیدی مختلف: توزیع وضعیت آلودگی به ویروس کمبود ایمنی گاو در گروه­های سنی مختلف در جدول 2، در گاوها با درجه وضعیت بدنی مختلف در جدول 3 و در گاوها با میزان تولید شیر مختلف در جدول 4 خلاصه شده­اند:

 

 

 

 

 

 

جدول 2- توزیع فراوانی مطلق و نسبی آلودگی با ویروس کمبود ایمنی گاو در گروه­های سنی مختلف در گاوهای مورد مطالعه

  آلودگی

 

سن (سال)

دارد

ندارد

جمع

فراوانی

درصد

فراوانی

درصد

فراوانی

درصد

6

1

10

9

90

10

100

7

0

0

13

100

13

100

8

0

0

12

100

12

100

9

0

0

8

100

8

100

10

0

0

5

100

5

100

11

0

0

2

100

2

100

جمع

1

2

49

98

50

100

 

جدول 3- توزیع فراوانی مطلق و نسبی آلودگی به ویروس کمبود ایمنی گاو در گاوها با درجه وضعیت بدنی (B.C.S) مختلف

آلودگی

 

B.C.S

دارد

ندارد

جمع

فراوانی

درصد

فراوانی

درصد

فراوانی

درصد

2-1

0

0

11

100

11

100

3-25/2

1

2/8

35

97/2

36

100

4-25/3

0

0

3

100

3

100

جمع

1

2

49

98

50

100

 

جدول 4- توزیع فراوانی مطلق و نسبی آلودگی به ویروس کمبود ایمنی گاو در گاوها با میزان تولید شیر مختلف

آلودگی

 

تولید شیر

دارد

ندارد

جمع

فراوانی

درصد

فراوانی

درصد

فراوانی

درصد

کم (kg 15-10)

0

0

15

100

15

100

متوسط (kg 25-15)

1

4/5

21

95/5

22

100

زیاد (بالای kg 25)

0

0

13

100

13

100

جمع

1

2

49

98

50

100


 


فراوانی آلودگی در گاوها بر اساس حضور اختلالات بالینی:  8 رأس از گاوهای مورد مطالعه واجد یک یا چند بیماری یا اختلال در دستگاه­های مختلف بودند که یک رأس از این گروه دام­ها (5/12 درصد) آلوده به ویروس کمبود ایمنی گاو تشخیص داده شدند (جدول 5). از 8 رأس گاو مذکور، یک رأس مبتلا به تب شیر در حال درمان، 4 رأس مبتلا به لنگش و ناراحتی
اندام­های حرکتی، یک رأس واجد اختلالات گوارشی (سوء هاضمه)، یک رأس مبتلا به تب برفکی و یک رأس مبتلا به پنومونی بودند.


 

 

جدول 5- توزیع فراوانی مطلق و نسبی آلودگی به ویروس کمبود ایمنی گاو در گاوهای واجد و فاقد اختلالات بالینی

آلودگی

 

اختلالات بالینی

دارد

ندارد

جمع

فراوانی

درصد

فراوانی

درصد

فراوانی

درصد

دارد

1

12/5

7

87/5

8

100

ندارد

0

0

42

100

42

100

جمع

1

2

49

98

50

100


 


فراوانی آلودگی در گاوها بر اساس واکنش یا بزرگ­شدگی عقده­های لنفاوی و عقده­های خونی: از 50 رأس گاو مورد مطالعه، 8 رأس دارای بزرگ­شدگی عقده­های لنفاوی بودند، که هیچ کدام از آنها آلوده به ویروس کمبود ایمنی تشخیص داده نشدند (جدول 6).

 

 

 

جدول 6- توزیع فراوانی مطلق و نسبی آلودگی به ویروس کمبود ایمنی گاو در گاوها بر اساس واکنش یا بزرگ شدگی عقده­های لنفاوی

آلودگی

 

بزرگی عقده­های لنفاوی

دارد

ندارد

جمع

فراوانی

درصد

فراوانی

درصد

فراوانی

درصد

دارد

0

0

8

100

8

100

ندارد

0

0

42

100

42

100

جمع

0

0

50

100

50

100

 

 

 

 

در 14 رأس (28 درصد) از 50 گاو مورد مطالعه، در معاینه بالینی، حضور یا بزرگ شدگی عقده­های خونی زیر پوستی در نواحی مختلف بدن مشخص گردید، که یک رأس از 14 رأس گاوی که عقده­های خونی آن­ها قابل تشخیص بودند (7 درصد)، آلوده به ویروس کمبود ایمنی گاو تشخیص داده شدند (جدول 7).

 

 

 

 

 

 

 

جدول 7- توزیع فراوانی مطلق و نسبی آلودگی به ویروس کمبود ایمنی گاو در گاوها بر اساس حضور یا بزرگی عقده­های خونی

            آلودگی

 

حضور عقده­های خونی دربالین

دارد

ندارد

جمع

فراوانی

درصد

فراوانی

درصد

فراوانی

درصد

دارد

1

7

13

93

14

100

ندارد

0

0

36

100

36

100

جمع

1

2

49

98

50

100

 

 

 

در آنالیز آماری هیچ ارتباط معنی­داری بین آلودگی گاوها با این ویروس و سن، درجه وضعیت بدنی، میزان تولید شیر، حضور اختلالات بالینی و بزگ شدگی عقده­های لنفاوی یا عقده­های خونیمشاهده نشد.

بحث و نتیجه­گیری

    ویروس کمبود ایمنی گاو لنتی­ویروسی می­باشد که با توجه به احتمال توانایی آن در ایجاد خسارات اقتصادی به صنعت گاوداری، بایستی در صنعت پرورش گاو، از مسائل مهم تلقی شده و لذا توجه متناسب را می­طلبد. با توجه به پراکندگی جهانی عفونت با این ویروس و مشخص نبودن کامل اختلالات بالینی و آزمایشگاهی همراه در گاوهای آلوده و همچنین نظر به فراوانی بالای آلودگی با BIV در گاوداری­های کشورهای مختلف و حتی ایرن و ارتباط این آلودگی­ها با وقوع انواع اختلالات بالینی و ضررهای اقتصادی منتج از آن و همچنین انجام مطالعات بسیار اندک در ایران و احتمال آلودگی بیشتر با افزایش سن و در نتیجه پیشنهاد وازد نمودن گاوهای پیر به ظاهر سالم، این تحقیق با هدف تعیین وضعیت آلودگی به این ویروس به روش Nested- PCR و بررسی اختلالات بالینی در گاوهای هلشتاین پیر در برخی گاوداری­های اطراف تبریز و عمدتاً واحدهای کوچک نیمه صنعتی و سنتی به اجرا در آمد. نتایج این بررسی نشان داد که آلودگی با ویروس کمبود ایمنی گاو در جمعیت گاوی مورد این مطالعه 2% می­باشد که این میزان آلودگی در مقایسه با نتایج به دست آمده از مطالعات قبلی صورت گرفته در ایران که میزان آلودگی را به روش شناسائی ژنومی در مناطق مختلف کشور، به ترتیب 3/20% (Nikbakht et al., 2009)، 2/16% (Tagipour Bazargani et al., 2010)، 60% (Tajbakhsh et al., 2010) و 5/7%  (Tolouei et al., 2010) نشان داده­اند، بسیار پائین می­باشد.

میزان آلودگی به این ویروس در گاوهای برخی مناطق دنیا از جمله ایالات متحده آمریکا بالا بوده در حالی که در برخی مناطق از جمله استرالیا و اروپا پائین است. طوری که بیشترین میزان آلودگی با این ویروس در برخی نواحی ایالات متحده آمریکا مثل لوئیزیانا، کلرادو و ایالات جنوب شرقی با میزان آلودگی در حدود بیش از 60 درصد در گاوهای شیری گزارش شده است (Radostitis et al., 2007; St. Cyr et al., 1994). برخی شواهد وجود دارد که در بعضی از گله­های گاوی که حیوانات بدون صرفه اقتصادی زیادی دارند، شیوع حیوانات سرم مثبت ممکن است به میزان بالای 95 درصد باشد. میزان وقوع آلودگی با این ویروس در کشورهای آسیایی، آمریکای جنوبی و آفریقائی نیز بالاست از جمله این میزان در ژاپن 25-15% (Meas et al., 2002 b; Usui et al., 2003)، کره 35% (Cho et al., 1999)، پاکستان 8/15% (Meas et al., 2000 b)، ترکیه 3/12% (Meas et al., 2003)، روسیه 32% (Kolotvin et al., 2007)،  کامبوج 3/26% (Meas et al., 2000 a)،  زامبیا 4/11% (Meas et al., 2004)، ونزوئلا 60-12%، برزیل 7/11% (Meas et al., 2002 a) و آرژانتین 42-2% (Gonzalez et al., 2008) بوده است. این در حالی است که میزان آلودگی در گاوهای شیری استرالیا، بالی، اندونزی و نیوزلند، 5-1% (Andrews et al., 2003; Barboni et al., 2001; Radostitis et al., 2007) و در کشورهای اروپایی از جمله آلمان 6/6%، فرانسه 4% (Polack et al., 1996)، هلند 4/1% (Horzinek et al., 1991) و ایتالیا 8/5% در گاوهای شیری و 5/2% در گاوهای گوشتی (Carivani et al., 1998)، گزارش شده که نسبتاً پائین می­باشد. شیوع عفونت در گاوهای شیری انتاریو نیز پائین است و ممکن است با کاهش در تولید شیر در ارتباط باشد. در گاوهای غرب کانادا نیز با استفاده از DNA مشتق از نمونه­های بافی­کوت و مایع منی آنالیز شده به­وسیله­ PCR نوع نستد، هیچ شواهدی از عفونت BIV یافت نشده است (Radostitis et al., 2007). در این مطالعه انجام یافته در تبریز، میزان آلودگی گاوها با ویروس کمبود ایمنی گاو به روش شناسائی ژنومی همانند کشورهای اروپائی، استرالیا و کانادا و برخلاف نتایج به­دست آمده در بررسی­های آسیایی، آفریقایی و آمریکای جنوبی، بسیار پائین می­باشد. در برخی کشورهای دیگر جهان نیز از جمله پرتغال، سوئیس، کرواسی، چین، کاستاریکا و هندوستان آلودگی گاوها با این ویروس گزارش شده است ( Munro et al., 1998; Patil et al., 2003; Meas et al., 2000; Carivani et al., 1998).

در مطالعات محدود و قبلی صورت گرفته در ایران که به روش تشخیص ژنومی ویروس کار شده، میزان آلودگی گاوها به­ترتیب در استان تهران، 3/20% (Nikbakht et al., 2009) و 2/16% (Tagipour Bazargani et al., 2010)، در استان چهارمهال بختیاری 60% (Tajbakhsh et al., 2010) و در استان آذربایجان­شرقی 5/7% (Tolouei et al., 2010) گزارش شده است که میزان آلودگی در مقایسه با بررسی حاضر، در سه گزارش اول، بسیار بالا و در مطالعه آخر، نسبتا بالا می­باشد. دو مطالعه­­ اول در کشتارگاه میثم تهران، مطالعه سوم در گاوداری­های استان چهارمحال و بختیاری و مطالعه چهارم در گاوداری­های صنعتی استان آذربایجانشرقی-تبریز انجام گرفته­اند. با در نظر گرفتن نتایج این چهار مطالعه قبلی به­علاوه بررسی حاضر می­توان نتیجه گرفت که اولاً میزان آلودگی گاوان با ویروس کمبود ایمنی گاو در مناطق مختلف ایران متفاوت بوده و ثانیاً این آلودگی در گاوان اطراف تبریز میزان نسبتا پائینی دارد. علت چنین تفاوتی را می­توان به منشا گاوهای مورد مطالعه در این بررسی­ها نسبت داد طوری که، در دو مطالعه اول انجام یافته در استان تهران، جمعیت گاوهای مورد بررسی، گاوهای ماده کشتاری بودند که به کشتارگاه میثم ارجاع داده شده بودند که احتمالاً حضور تعداد زیاد گاوداری­های صنعتی بزرگ با سیستم پرورش بسته در کل و بی­توجهی به بهداشت در این ارتباط در نواحی اطراف تهران، که بخشی از این دام­ها نیز در کشتارگاه میثم کشتار می­شوند، و همچنین وازد بودن بخش اعظم ماده گاوهای ارجاعی به کشتارگاه، در بالا بودن میزان آلودگی بررسی­های مذکور بدون نقش نبوده­اند. همچنین تفاوت بسیار بالای میزان شیوع ویروس کمبود ایمنی گاو در چهارمحال و بختیاری (60%) و مطالعه­ حاضر، ممکن است به علت رخداد آلودگی در انجام روش نستدPCR   مطالعه­ فوق که روش بسیار حساس می­باشد یا تفاوت وضعیت آب و هوایی و ناحیه­ جغرافیایی باشد. هم در مطالعه قبلی انجام­یافته در گاوهای ناحیه تبریز (Tolouei et al., 2010) و هم در مطالعه حاضر میزان آلودگی به این ویروس در مقایسه با مطالعات صورت گرفته در مناطق دیگر ایران، نسبتاً پائین است، ولی به هر حال، تفاوت در میزان آلودگی در نتایج این دو بررسی قبلی و حاضر انجام شده در تبریز را می توان به تفاوت در نوع گاوداری­های مورد نمونه­برداری، تراکم دام ها و بزرگی دامداری­ها نسبت داد. تراکم بالای گاوها امکان انتشار ویروس را افزایش خواهد داد و در گاوداری­های با تراکم بالا افزایش معنی­داری در درصد وقوع آلودگی با این ویروس دیده شده است (Carivani et al., 1998; Snider et al., 1996). در مطالعه­ حاضر 90%  نمونه­ها (45 رأس گاو) از دامداری­های کوچک (تقریباً 20-10 رأسی) جمع آوری شده بودند در حالی که در مطالعه­ قبلی انجام شده، بین 24 نمونه­ مثبت از 320 نمونه­ مورد مطالعه، 14 نمونه مربوط به گاوداری­های صنعتی بزرگ، 10 نمونه مربوط به گاوداری­های صنعتی کوچک و گاوداری سنتی بودند (3%). تاثیر سن دام­ها در حساسیت به آلودگی با این ویروس، شناسایی شده است (Belloc et al., 1996; St. Cyr et al., 1994) و در مطالعاتی نشان داده شد که میزان آلودگی با افزایش سن گاوها افزایش می­یابد (Barboni et al., 2001; Carivani et al., 1998; St. Cyr et al., 1994). در این بررسی، رابطه­ بین افزایش میزان آلودگی با افزایش سن گاوها معنی­دار نبود و نتایج مطالعات مذکور، مغایر با نتایج این بررسی هستند. البته با توجه به پائین بودن درصد کل آلودگی در مطالع حاضر، می­توان نتیجه گرفت که معنی­دار نبودن ارتباط سنی شاید به دلیل ناکافی بودن تعداد نمونه­های مثبت یا به­عبارتی پائین بودن میزان آلودگی در کل مطالعه باشد. 

ارتباط معنی­داری بین آلودگی گاوها با این ویروس و درجه وضعیت بدنی آنها مشاهده نشد با این حال در برخی گزارشات، لاغری و کاهش وزن به عنوان یکی از نشانه­های بالینی آلودگی با این ویروس ذکر می­شود (Meas et al., 2000 b; Polack et al., 1996; Snider et al., 2003 a; Gonda et al., 1987; Snider et al., 1996). در بررسی حاضر رابطه معنی­داری بین میزان آلودگی گاوها و حضور اختلالات بالینی یا آسیب­های درشت­بینی و همچنین واکنش ظاهری عقده­های لنفاوی در آنها مشاهده نشد که این نتایج همانند نتایج مطالعاتی هست که ارتباط پایدار و قابل توجهی را بین آلودگی به این ویروس و ایجاد بیماری بالینی اختصاصی در گاوها، مستند نکرده و نقش آن را در ایجاد بیماری در گاو، نامعلوم اعلام می­نمایند (St.Cyr et al., 1994; Radostitis et al., 2007). با اینکه در برخی بررسی­ها، درجات متفاوت لمفادنوپاتی عمومی یا موضعی را در این آلودگی ذکر کرده­اند (Andrews et al., 2003; Snider et al., 2003 b) ولی عموماً معتقدند که هیچ ارتباط معنی­داری بین واکنش و بزرگ شدگی عقده­های لنفاوی و آلودگی به این ویروس، وجود ندارد (Snider et al., 2003a; Snider et al., 1996; Munro et al., 1998) که نتایج بررسی حاضر نیز با این موضوع هم­راستا است. بین میزان آلودگی به این ویروس و حضور یا بزرگ شدگی عقده­های خونی در معاینه بالینی، رابطه­ معنی­داری وجود نداشت که این نتیجه برخلاف یافته­های گزارشاتی که بزرگ شدگی عقده­های خونی را به­عنوان یکی از نشانه­های قابل توجه در گاوهای آلوده به ویروس کمبود ایمنی ذکر کرده­اند (Brownlie et al., 1994; Tagipour Bazargani et al., 2010; Munro et al., 1998; Snider et al., 2003 b) بوده و همانند نتیجه­ مطالعه­ای می­باشد که بزرگ­شدگی عقده­های خونی را فقط در یک مورد از 59 گاو واجد آلودگی طبیعی به این ویروس مشاهده نمودند (Snider et al., 1996). به هر حال در مطالعه حاضر میزان آلودگی گاوهای هلشتاین گاوداری­های عمدتاً واحدهای کوچک و سنتی با ویروس کمبود ایمنی گاو به روش تشخیص DNA پروویروسی، بسیار پائین بود. لذا، با توجه به نتایج این مطالعه و با در نظر گرفتن این مسئله که تراکم دام­ها نیز در انتشار ویروس می­تواند حائز اهمیت باشد، می­توان از کوچک کردن واحدهای دامپروری و کاهش تراکم در گاوداری­ها، به­عنوان یکی از راهکارهای پیشگیری و کنترل آلودگی با BIV استفاده نمود. به نظر می­رسد که شرایط نگه­داری به عنوان یکی از فاکتورهای بسیار مهم در درگیری گاوها به این ویروس ایفای نقش می­کند. لذا، نیاز به انجام مطالعات دیگر و تکمیلی در خصوص آلودگی گاوهای نگه­داری شده در گاوداری­های کاملاً سنتی و همچنین گاوهای بومی کشور احساس می­شود.  

  • Andrews, A.H., Blowy, W., Boyd, H. and Eddy, R.G. (2003). Bovine Medicine. 2nd Edition, Oxford UK, Blackwell Science, pp. 693-700.
  • Avidan, O. and Hizi, A. (2008). Expression and characterization of the integrase of bovine immunodeficiency virus. Virology, 371(2):309-21.
  • Barboni, P., Thompson, I., Brownile, J., Hartningsih, N. and Collins, M.E. (2001). Evidence of the presence of two bovine lentiviruses in cattle population of bali. Veterinary Microbiology, 80:313-327.
  • Baron, T., Betemps, D., Mallet, F., Chenyet, V., Levly, D. and Belli, P. (1998). Detection of Bovine immunodeficiency –like virus infection in experimentally infected calves. Archive of Virology, 143:181-189.
  • Belloc, C., Polack, B., Schwartz-Cornil, I., Brownlie, J. and Levy, D. (1996). Bovine immunodeficiency virus: facts and questions. Veterinary Research, 27:395-402.
  • Brownlie, J., Collins, M.E. and Heaton, P. (1994). Bovine immunodeficiency-like virus- a potential cause of disease in cattle. Veterinary Record, 134:289-291.
  • Carivani, S., Donofrio, G., Chiocco, D., Foni, E., Martelli, P., Allegri, G., Cabbasi, C.S., De Iaco, B. and Flammini, C.F. (1998). Seroprevalece to Bovine immunodeficiency virus and lack of association with leukocyte counts in Italian dairy cattle. Preventive Veterinary Medicine, 37:147-157.
  • Cary, A.M., Pharr, G.T., Murphey, J., Hughlett, M.B., Weaver, C.C., Nelson, P.D. and Coats, K.S. (2002). Confirmation of vertical transmission of bovine immunodeficiency virus in naturally infected dairy cattle using the polymerase chain reaction. Journal of Veterinary Diagnostic Investigation, 14:113–119.
  • Cho, K.O., Meas, S., Park, N.Y., Kim, Y.H., Lim, Y.K., Endoh, D., Lee, S.I., Oashi, K., Sugimoto, C. and Onuma, M. (1999). Seroprevalence of Bovine Immunodeficiency virus in dairy and beef cattle heards in Korea. Journal of Veterinary Medical Scienc, 61:549-551.
  • Evermann, F.J., Howard, T.H., Dubovi, E.J., Knowles, D.P. Jr., Miller, L.D., Pearson, J.E., Snider, T.G. and Suarez, D.L. (2000). Controversies and clarifications regarding bovine lentivirus infections. Journal of American Veterinary Medical Association, 217:1318-1324.
  • Garvey, K.J., Oberste, M.S., Elser, J.E., Braun, M.J. and Gonda, M.A. (1990). Nucleotide sequence and genome organization of biologically active proviruses of the bovine immunodeficiency-like virus. Virology, 175:391-409.
  • Gonda, M.A., Luther, D.G., Fong, S.E. and Tobin, G.J. (1994). Bovine immunodeficiency virus: molecular biology and virus-host interactions. Virus Research, 32:155-181.
  • Gonzalez, E.T., Licursi, M., Vila Roza, V., Bonzo, E., Mortola,E., Frossard, J.P. and Venables, C. (2008). Evidence of bovine immunodeficiency virus (BIV) infection: Serological survey in Argentina. Research in Veterinary Science, 85:353-358.
  • Gradil, C.M., Watson, R.E., Renshaw, Gibert, R.O. and Dubovi, E.J. (1999). Detection of Bovine Immunodeficiency Virus DNA in the blood and serum of experimentally infected bulls. Veterinary Microbiology, 70:21-23.
  • Hirai, N., Furuyama, H., Awaya, A. and Onuma, M. (1995). Effect of administration of serum thymic factor (FTS) in calves and rabbits infected with bovine immunodeficiency-like virus. Journal of Veterinary Medical Science, 57:307-310.
  • Horzinek, M., Keldermans, L., Stuurman T., Black J., Herrewegh A., Sillekens P. and Koolen M. (1991). Bovine immunodeficiency virus: immunochemical characterization and serological survey. Journal of General Virology, 72:2923-2928.
  • Isaacson, J.A., Flaming, K.P. and Roth, J.A. (1998). Effects of long - term infection with Bovine immunodeficiency virus and/or bovine leukemia virus on antibody and lymphocyte proliferative responses in cattle. Veterinary Immunology and Immunopathology, 64:249-266.
  • Kolotvin, V.V., Grinenko, N.F., Piskareva, L.M., Pashvykina, G.V., Shaikhaev, G.O., Al'tshtin A.D. and Valikhov, F. (2007). Distribution of Bovine Immunodeficiency Virus in Herdsof Moscow Region and Stavropol Krai. Russian Agriculture Sciences, 1:54-56.
  • Lew, A.E., Back, R.E., Miles, J., Cuttell, L.B., Steer, P. and Nadin-Davis, S.A. (2004). Sensitive and specific detection of Bovine immunodeficiency virus and syncytial virus by 5 Taq nuclease assays with fluorescent 3 minor groove binder - DNA probs. Journal of Virological Methods, 116:1-9.
  • Meas, S., Nakayama, M., Usui, T., Nakazato, Y., Yasuda, J., Ohashi, K. and Onuma, M. (2004). Evidence for Bovine immunodeficiency virus infection in cattle in Zambia. Japanese Journal of Veterinary Research, 52:3-8.
  • Meas, S., Ohashi, K., Sugimoto, C. and Onuma, M. (2001). Phylogenetic relationships of bovine immunodeficiency virus in cattle and buffaloes based on surface envelope gene sequences. Archive of Virology, 146:1037-1045.
  • Meas, S., Ohashi, K., Tum, S., Chhin, M., Te, K., Miura, K., Sugimuto, C. and Onuma, M. (2000a). Seroprevalence of Bovine immunodeficiency virus and Bovine leukemia virus in draught animals in Combodia. Journal of Veterinary Medical Science, 62:779-781.
  • Meas, S., Seto, J., Sugimoto, C., Bakhsh, M., Riaz, M., Sato, T., Naeem, K., Ohashi, K. and Onuma, M. (2000b). Infection of Bovine Immunodeficiency virus and bovine leukemia virus in water buffalo and cattle populations in Pakistan. Journal of Veterinary Medical Science, 62:329-331.
  • Meas, S., Ruas, J., Farias, N.A., Usui, T., Teraoka, Y., Mulenga, A., Chang, K. S., Masuda, A., Madruga, C.R., Ohashi, K. and Ouma, M. (2002a). Seroprevalence and molecular evidence for the presence of bovine immunodeficiency virus in Brazilian cattle. Japanese Journal of Veterinary Research, 50:9-16.
  • Meas, S., Usui, T., Ohashi, K., Sugimoto, C. and Onuma, M. (2002b). Vertical transmission of bovine leukemia virus and bovine immunodeficiency virus in dairy cattle herds. Veterinary Microbiology, 84:275-282.
  • Meas, S., Yilmaz, Z., Usui, T., Torun, S., Yesilbag, K., Ohashi, K. and Onuma, M. (2003). Evidance of bovine immunodeficiency virus in cattle in Turkey. Japanese Journal of Veterinary Research, 51:3-8.
  • Munro, R., Lysons, R., Venables, C., Horigan, M., Jeffery, M. and Dawson, M. (1998). Lymphadenopathy and non-suppurative meningo-encephelitis in calves experimentally infected with bovine immunodeficiency-like virus (FL112). Journal of Comparative Pathology, 119:121-34.
  • Nadin-Davis, S.A., Chang, S.C., Smith, H. and Jacobs, R.M. (1993). Detection of bovine immunodeficiency-like virus by the polymerase chain reaction. Journal of Virological Methods, 42:323-336.
  • Nash J.W., Hanson L.A. and Coats K. (1995). Bovine immunodeficiency virus in stud bull semen. American Journal of Veterinary Research, 65(6):760-763.
  • Nikbakht Brujeni, G.h., Poorbazargani, T.T., Nadin-Davis, S., Tolouei, M. and Barjesteh, N. (2009). Bovine  mmunodeficiency virus and bovine leukemia virus and their mixed  infection in Iranian Holstein cattle. Journal of Infection in Developing Countries, 4(9):576-579.
  • Orr, K.A., O’Reilly, K.L. and Scholl, D.T. (2003). Estimation of sensitivity and specificity of two diagnostics tests for bovine immunodeficiency virus using Bayesian techniques. Veterinary Medicine, 61:79-89.
  • Patill, S.S., Pattna, K.B., Mishra, N., Banumathi, N., Dubey, R. and Pradhan, H.K. (2003). Detection of proviral genomic sequence of Bovine Immunodeficiency Virus in Indian cattle. Current Science, 84:563-566.
  • Polack, B., Schwartz, I., Berthelemy, M., Belloc, C., Manet, G., Vuillaume, A., Baron, T., Gonda, M.A. and Levy, D. (1996). Serologic evidence for Bovine immunodeficiency virus infection in France. Veterinary Microbiology, 48:165-173.
  • Radostitis, O.M., Gay, C.C., Hinchcliff, K.H. and Constable, P.D. (2007). Veterinary medicine. 10th Edition, Saunders Elsevier, London, UK, pp. 1046-1058, 1221-1223.
  • Scholl, D.T., Truax, R.E., Baptista, J.M., Ingawa, K., Orr, K.A., O'Reilly, K.L. and Jenny, B.F. (2000). Natural transplacental infection of dairy calves with bovine immunodeficiency virus and estimation of effect on neonatal health. Preventive Veterinary Medicine, 43:239-252.
  • Snider, T.G., Hoyt, P.G., Coats, K.S., Graves, K.F., Cooper, C.R., Storts, R.W., Luther, D.G. and Jenny, B.F. (2003a). Natural bovine lentiviral type 1 infection in Holestein dairy cattle. Clinical, serological and pathological observation. Comparative Immunology Microbiology and Infectious Diseases, 26:89-101.
  • Snider, T.G., Coats, K.S., Storts, R.W., Graves, K.F., Cooper, C.R., Hoyt, P.G., Luther, D.G. and Jenny, B.F. (2003b). Natural bovine lentivirus type 1 infection in Holstein dairy cattle. II. Lymphoid tissue lesions. Comparative Immunology Microbiology and Infectious Diseases, 26:1-15.
  • Snider, T.G., Luther, D.G., Jenny, B.F., Hoyt, P.G., Battles, J.K., Ennis, W.H., Balady, J., Blas - Machado, U., Lemerchand, T.X. and Gonda, M.A. (1996). Encephalatitis, Lymphoid tissue depletion and secondary diseases associated with Bovine immunodeficiency Virus in a dairy herd. Comparative Immunology Microbiology and Infectious Diseases, 19:117-131.
  • Surarez, D.L., Van Der Maaten, M.J., Wood, C. and Whetstone, C.A. (1993). Isolation and characterization of new wild – type isolates of bovine lentivirus. Journal of Virology, 67:5051-5055.
  • St. Cyr, C., Stephen, K., Pruett, B., Jerry, W. N. and Carlton, R.C. (1994). Bovine immunodeficiency virus: incidence of infection in Mississippi dairy cattle. Veterinary Microbiology, 42:181-189.
  • Tagipour Bazargani, T.T., Tolouei, M., Nikbakht Brojeni, G.R., Garagozlo, M.J., Bokaei, S., Khormali, M. and Barjaste, N. (2010). The first survey on the status of the Bovine Immunodeficiency Virus infection and associated clinical, pathological, haematological and flow cytometrical findings in Holstein cattle in Iran. Journal of Veterinary Researches, 65(1): 1-11[In Farsi].
  • تقی پور بازرگانی، ت.ت.، طلوعی، م.، نیکبخت بروجنی، غ.ر.، قره گوزلو، م.ج.، بکائی، س.، خرمالی، م. و برجسته، ن. (1389). اولین بررسی بالینی وضعیت آلودگی به ویروس کمبود ایمنی گاو و یافته­های پاتولوژیک، هماتولوژیک و فلوسایتومتریک در گاوهای هلشتاین ایران. مجله تحقیقات دامپزشکی، دوره 65، شماره 1، صفحات 11-1.
  • Tajbakhsh, E. Nikbakht Borujeni, Gh., Momtazan, H. and Amirmozafari, N. (2010). Molecular prevalence for Bovine immunodeficiency virus infection in Iranian cattle population. African Journal of Microbiological Research, 4(12):1199-1202.
  • Tolouei, M., Nikbakht Brojeni, G.R., Siofi, B., Ashrafi, J. and Jafari Jozani, R. (2010). A study on the Bovine Immunodeficiency Virus infection by using the PCR method and assocciated clinical, heamatological and histopatological changes in dairy farms in Tabriz. University of Tabriz, Iran Patent D.27.1102: 5-7 [In Farsi].
  • طلوعی، م.، نیکبخت بروجنی، غ.، سیوفی، ب.، اشرفی، ج. و جعفری جوزانی، ر. (1389). مطالعه­ی وضعیت آلودگی به ویروس کمبود ایمنی گاو به روش واکنش زنجیره­ای پلی مراز و تغییرات بالینی، هماتولوژیک و هیستوپاتولوژیک همراه در گاوداری­های شیری اطراف تبریز. گزارش نهائی طرح تحقیقاتی مصوب شماره 1102/27/د دانشگاه تبریز، صفحات 7-5.
  • Usui, T., Meas, S., Konnai, S., Ohashi, K. and Onuma, M. (2003). Seroprevalence of Bovine immunodeficiency virus and Bovine leukemia virus in Dairy and Beef cattle in Hokkaido. Journal of Veterinary Medical Science, 65:287-289.
  • Vandermaaten M.J., Boothe A.D. and Seger C.L. (1972). Isolation of a virus from cattle with persistent lymphocytosis. Journal of the National Cancer Institute, 49:1649-1657.
  • Walder, R., Kalvatchev, Z., Perez, F., Garzaro, D. and Barrios, M. (2001). Bovine immunodeficiency virus infection in experimentally infected rabbit: tropism for lymphoid and nonlymphoid tissues. Comparative Immunology Microbiology and Infectious Diseases, 24:1-20.