تشخیص مولکولی باکتری آئروموناس هیدروفیلا در ماهیان قرمز آکواریومی و قزل‌آلای رنگین‌کمان پرورشی استان چهارمحال و بختیاری

نوع مقاله: علمی پژوهشی

نویسنده

دانشگاه آزاد اسلامی، واحد شهرکرد، دانشیار گروه بهداشت و بیماری‌های آبزیان، دانشکده دامپزشکی، شهرکرد، ایران.

چکیده

   باکتری آئروموناس هیدروفیلا عامل سپتی­سمی آئروموناس‌های متحرک در ماهیان آب‌های شیرین و شور است.مطالعه حاضر با هدف ردیابی باکتری آئروموناس هیدروفیلا در ماهیان قرمز آکواریومیو قزل­آلای رنگین­کمان پرورشی استان چهارمحال و بختیاری صورت گرفت. بدین منظور، از مراکز فروش ماهیان زینتی تعداد 50 عدد ماهی قرمز و از 6 مزرعه پرورش ماهی قزل­آلای رنگین­کمان به ازای هر مزرعه 10 عدد و در مجموع 60 عددبه طور تصادفی از ماهیان مشکوک به بیماری نمونه­برداری انجام گردید. در خصوص ماهیان قرمز از میانگین وزنی 3 تا 5 گرم و در ماهیان قزل­آلای رنگین­کمان از میانگین وزنی 10 تا 20 گرم استفاده شد. ابتدا از کبد و کلیه تمام ماهیان نمونه‌برداری باکتریایی و کشت بر روی محیط آگار خون­دار انجام گرفت.سپسمحیط‌ها به انکوباتور منتقل و پس از گرمخانه‌گذاری در دمای 22 درجه سانتی­گراد به مدت 24 ساعت، بر روی پرگنه‌های رشد یافته آزمون‌های کاتالاز، اکسیداز و رنگ گرم انجام شد و آن‌هایی که گرم منفی، کاتالاز و اکسیداز مثبت بودند در محیط کشت ریملر شاتس (محیط انتخابی آئروموناس هیدروفیلا) کشت داده شد و پس از گرمخانه‌گذاری در دمای 22 درجه سانتی­گراد به مدت 48 ساعت، از پرگنه‌های رشد یافته با استفاده از زوج پرایمرهایالیگونوکلئوتیدی مربوط به ژن lipآزمون PCRصورت پذیرفت. طی بررسی مولکولی باکتری‌های جدا شده از ماهیان قزل­آلای رنگین­کمان تعداد 9 جدایه و با بررسی ماهیان قرمز تعداد 6 جدایه به عنوان آئروموناس هیدروفیلا شناسایی گردید.با توجه به ردیابی باکتری آئروموناس هیدروفیلا در هر دو گروه ماهیان قرمز و قزل­آلای رنگین­کمان، در صورت رعایت نکردن اصول مدیریت بهداشتی در آبزی پروری این باکتری می‌تواند منجر به شیوع سپتی­سمی همراه با تلفات گردد. 

کلیدواژه‌ها


عنوان مقاله [English]

Molecular detection of Aeromonas hydrophila in the aquarium gold fish and cultured rainbow trout in Chaharmahal va Bakhtiary province

نویسنده [English]

  • firouz Fadaeifard
چکیده [English]

   Aeromonas hydrophilia   is the etiologic agent of motile aeromonas septicaemia, one of the most important bacterial diseases of fresh and marine water fishes. The aim of the present study was detection of A. hydrophilia in the aquarium goldfish and cultured rainbow trout in Chaharmahal va Bakhtiary province.  In this study 50 goldfish from aquarium fish shops and 60 rainbow trouts suspected of having the disease from 6 farms (10 fish in each farm) were randomly collected. The average weight in goldfish and rainbow trout samples were 3-5 g and 10-20 g, respectively. Sampling was performed from kidney and liver, and inoculated into blood agar and incubated at 22°C for 24 hours. Pure colonies which are grown on the mediums were tested by catalase, oxidase and gram staining, then those of gram-negative, catalase and oxidase positive were diagnosed, and cultured on Shotts-Rimler medium (as selective medium for A. hydrophila). These mediums were incubated at 22 °C for 24-48 h. The typical colonies were tested by using oligonucleotide primers of lip gene by PCR method. In light of molecular analysis of all specimens, 9 and 6 isolates from rainbow trout and gold fishes were identified as A. hydrophila respectively. Due to the detection of A. hydrophila in both cultured rainbow trout and aquarium goldfish, the bacteria can lead to septicemia with mortality if the health management principles are not observed in fish farming.

کلیدواژه‌ها [English]

  • Aeromonas hydrophila
  • Motile aeromonas septicemia
  • Rainbow trout
  • Goldfish
  • Chaharmahal va Bakhtiary

مقدمه

   شایع‌ترین بیماری‌های عفونی ماهیان زینتی بیماری‌های باکتریایی است و اکثر عفونت‌های باکتریایی نیز توسط ارگانیسم‌های گرم منفی ایجاد می‌شود. آئروموناس هیدروفیلا عامل سپتی­سمی آئروموناس‌های متحرک دارای انتشار جهانی است و منجر به بروز عفونت در ماهیان، پرندگان و هم‌چنین انسان شده و در برخی از نقاط دنیا باعث تلفات شدید در بین ماهیان پرورشی می‌گردد. شیوع بالای عفونت‌های ناشی از این باکتری را می‌توان به دلیل حضور آنها در فلور طبیعی روده ماهیان آب شیرین و دریایی دانست. در طبیعت این باکتری به طور گسترده در رسوبات آب‌های شیرین و دستگاه گوارش ماهی وجود دارد (Uma et al., 2010 Lewbart, 2010;).

   گزارشاتی از کشورمان مبنی بر جداسازی و تشخیص، خصوصیات ایمنی­زایی یا اثر باکتری مذکور بر پاسخ‌های ایمنی ماهیان پرورشی صورت گرفته است. در این زمینه می‌توان به معرفی باکتری مذکور به عنوان عامل بیماری‌زایی کپور ماهیان پرورشی (رضویلر و همکاران، 1360)، جداسازی باکتری‌های شبیه آئروموناس‌های متحرک از ماهیان آمور تلف شده استان خوزستان (اسماعیلی و پیغان، 1376)، تشخیص باکتری‌های آئروموناس هیدروفیلای جدا شده از ماهیان و میگوهای پرورشی ایران با تکنیک آنتی­­بادی درخشان به روش غیرمستقیم (ربانی و سلطانی، 1378) و جداسازی آئروموناس هیدروفیلا از قزل­آلای پرورشی استان فارس (اخلاقی، 1377) اشاره نمود. در خصوص شناسایی باکتری آئروموناس هیدروفیلا از تکنیک‌های مختلف باکتری‌شناسی، بیوشیمیایی و سرم‌شناسی استفاده شده است ولی امروزه جهت تشخیص دقیق و سریع این پاتوژن از آزمون‌های مولکولی از جمله PCR، RFLP (Restriction Fragment Length Polymorphism) و تکنیک انگشت‌نگاری DNA بهره گرفته می‌شود. با استفاده از تست پی سی آر چند گانه (Multiplex PCR) نیز به‌طور همزمان ژن‌های همولیزین خارج سلولی ahh1 و آئرولیزین aerA در سویه‌های آئروموناس هیدروفیلا قابل ردیابی می‌باشد (Wang et al., 2003). در جستجوی علت مرگ مشکوک یک گربه ماهی زال آکواریومی (Clarias sp.)، پس از کشت باکتریایی از کلیه آن و انجام آزمایشPCR  جهت ردیابی ژن‌های همولیزین و آئرولیزین خارج سلولی نتایج نشان داد که علت مرگ این ماهی باکتری آئروموناس هیدروفیلا بوده است (Choresca et al., 2010). از جمله آزمون‌های ارتقاء یافتهPCR  می‌توان به Triplex PCR اشاره کرد که در آن با استفاده از سه جفت پرایمر ویژه باکتری آئروموناس هیدروفیلا سه ژن 16SrRNA ،آئرولیزین (Aerolysisn) و سرین–پروتئاز (serine-protease) ردیابی می‌گردد. در این آزمون برخلاف Multiplex PCR که هم‌زمان دو یا چند باکتری یا ویروس مورد شناسایی قرار می‌گیرد، از ژن‌های شناخته شده یک باکتری به‌طور هم‌زمان در شناسایی آن استفاده می‌گردد. از ویژگی‌های این آزمون آن است که با اجتناب از احتمال خطای تشخیص از طریق یک ژن و با ردیابی چند ژن از یک باکتری کمک به شناسایی دقیق و سریع‌تر آن می‌شود (Wang et al., 2008). اخیراً نیز با یکی کردن آزمون 16S rDNA PCR و فناوری DNA hybridization یک ریزآرایه (microarray) طراحی شده که از آن برای ردیابی هم‌زمان و تشخیص هشت پاتوژن مهم ماهی (از جمله آئروموناس هیدروفیلا) که بیشترین درگیری را در آبزی پروری دارند استفاده شده است. اینDNA  ریزآرایه دارای حساسیت و ویژگی بالایی بوده و از آن می‌توان در تشخیص سریع عوامل بیماری‌زای ماهی استفاده نمود (Chang et al., 2012).

با توجه به توسعه پرورش ماهی قزل­آلای رنگین­کمان در کشورمان و به ویژه در استان چهار محال و بختیاری و مشاهده مکرر تلفات ناشی از عوامل باکتریایی در بین این ماهیان از طرفی و متاسفانه رهاسازی ماهیان قرمز در منابع آبی و تالاب‌های این استان از طرف دیگر، تصمیم به انجام تحقیق حاضر با هدف بررسی مولکولی ماهیان قرمز آکواریومی و قزل­آلای رنگین­کمان پرورشی در آلودگی به باکتری آئروموناس هیدروفیلا گرفته شد. ویژگی این تحقیق شناسایی پاتوژنی است که در هر دو گروه ماهیان مورد هدف قادر به بیماری‌زایی و ایجاد تلفات یا ضایعات درمانگاهی است و نتیجه آن از ابعاد مختلف بیماری‌شناسی، همه‌گیرشناسی و زیست محیطی حائز اهمیت خواهد بود.

 

مواد و روش‌ها

   این تحقیق در تابستان 1391 و با مشاهده علائم بیماری مشکوک به سپتی­سمی آئروموناس‌های متحرک در بین ماهیان قزل­آلای رنگین­کمان پرورشی و ماهیان قرمز آکواریومی انجام پذیرفت. در خصوص نمونه‌های قزل­آلا 6 مزرعه در استان چهارمحال و بختیاری انتخاب و از هر کدام 10 نمونه (مجموعاً 60 عدد) و در ارتباط با ماهی قرمز نیز با مراجعه به فروشگاه‌های ماهیان زینتی شهر کرد، 50 نمونه از ماهیان مشکوک به سپتی­سمی آئروموناسی برداشت و در کنار یخ به آزمایشگاه میکروب‌شناسی دانشگاه آزاد اسلامی شهرکرد انتقال داده شد. علائم مورد نظر در کلیه ماهیان مشکوک به بیماری شامل اتساع شکم، بیرون زدگی چشم و التهاب مخرج بوده است که علاوه بر این موارد، در ماهیان قرمز برآمدگی فلس و در ماهیان قزل­آلا تیرگی پوست نیز در شناسایی مورد نظر قرار گرفت.

   قبل از انجام عملیات نمونه‌برداری نسبت به اخذ اطلاعات کامل مزرعه‌ای از قبیل فاکتورهای مربوط به آب (فاکتورهای کیفی از جمله دما و اکسیژن)، ماهی (مشاهدات بالینی و کالبدگشایی ماهیان مشکوک)، غذا (ویژگی‌های فیزیکی و شیمیایی غذا) و تکمیل پرسشنامه‌های مربوطه اقدام گردید. در ادامه با باز کردن سطح شکمی ماهی و در کنار شعله توسط آنس استریل از کلیه و کبد آنها نمونه‌برداری صورت گرفت، به‌طوری که با وارد نمودن آنس در بافت‌های ذکر شده به محیط کشت آگار خون‌دار به عنوان یک محیط اولیه انتقال داده می‌شد. بر روی تمام محیط‌ها شماره و کد مربوطه درج و پس از اتمام عملیات نمونه‌گیری محیط‌های کشت به مدت 24 ساعت درانکوباتور با دمای22 درجه سلسیوس نگه­داری شده تا رشد پرگنه‌های مشکوک نمایان گردد. پس از رشد پرگنه‌ها از هر کدام تست‌های بیوشیمیایی کاتالاز، اکسیداز و همچنین رنگ‌آمیزی گرم صورت گرفته و آن‌هایی که کاتالاز و اکسیداز مثبت و گرم منفی بوده­اند جهت انتقال به محیط کشت شاتس ریملر (Shotts and Rimler, 1973) به عنوان محیط انتخابی آئروموناس هیدروفیلا انتخاب می‌شدند. بعد از 24 تا 48 ساعت گرمخانه‌گذاری در دمای 22 درجه سلسیوس نیز پرگنه‌های رشد یافته در آنها جدا و به محیط آب پپتونه منتقل شده و سپس به مدت 24 ساعت در انکوباتور با دمای 22 درجه سلسیوس نگه­داری گردید تا در ادامه از آن برای استفاده در آزمون PCR استفاده گردد.

استخراج DNA

   استخراج DNA از نمونه‌های باکتریایی بر اساس دستورالعمل کیت استخراج DNA ساخت شرکت سیناژن انجام شد.

انجام PCR برای تشخیص باکتری آئروموناس هیدروفیلا

   جهت تشخیص باکتری آئروموناس هیدروفیلا، واکنش PCR با استفاده از پرایمرهای مربوطه و بر اساس دستورالعمل توصیه شده توسط Cascon  و همکاران (1996) صورت گرفت. بدین‌منظور از پرایمرهای الیگونوکلئوتیدی که ردیابی قطعه 760 جفت بازی ژن lip مربوط به باکتری آئروموناس هیدروفیلا را بر عهده دارند استفاده شد (جدول 1). فرآیند تکثیر PCR با استفاده از یک دستگاه ترمال سایکلر DNA  مدل Ependorf)) صورت گرفت. در این واکنش از 5 میلی‌لیتر نمونه حاوی DNA ، 25/1 واحد Taq DNA polymerase، 5 میلی‌لیتر بافر تکثیر PCR شامل(100 mM Tris-HCl, 20 mM MgCl2, 500 mM KCl [pH 8.3])، mM 1 از هر پرایمر، mM 4/0 از دئوکسی نوکلئوتید تری فسفات و آب مقطر دو بار تقطیر شده تا حجم 50 میلی‌لیتراستفاده گردید. به‌ منظور جلوگیری از تبخیر نیز 50 میلی‌لیتر روغن معدنی به مخلوط فوق اضافه شد. در این واکنش از برنامه حرارتی واسرشته­سازیDNA  در 94 درجه سلسیوس به مدت 1 دقیقه، اتصال پرایمرها در 62 درجه سلسیوس به مدت 60 ثانیه، توسعهDNA  در 72 درجه سلسیوس به مدت یک‌ونیم دقیقه و توسعه نهایی در 72 درجه سلسیوس به مدت 5 دقیقه استفاده گردید. البته مراحل واسرشته‌سازی، اتصال و توسعه 40 بار تکرار می‌گردید. در آخر نیز با انتقال محصول PCR درون ژل آگارز یک درصد و رنگ‌آمیزی آن با اتیدیوم بروماید (با غلظت 5/0 میکروگرم در میلی‌لیتر) و تصویربرداری از طریق دستگاه الکتروفورز اقدام به مشاهده نتایج در کنار نمونه کنترل منفی(آب مقطر) و مارکر 100 جفت بازی گردید (شکل 1).

 

 

جدول 1- مشخصات پرایمرهای مورد استفاده در تشخیص باکتری آئروموناس هیدروفیلا

نام ژن 

                                             پرایمر

اندازه قطعه ژنی(جفت باز)

              منبع

lip

(F):5´ AACCTGGTTCCGCTCAAGCCGTTG 3´

(R):5´- TTGCTCGCCTCGGCCCAGCAGCT3´

                760

Cascon et al,1996

 


یافته­ها

   طی بررسی 6 مزرعه پرورش ماهی قزل­آلای رنگین‌کمان استان چهارمحال و بختیاری و نمونه‌برداری از  60 عدد ماهی و هم‌چنین اخذ 50 عدد ماهی قرمز خریداری شده از فروشگاه‌های ماهیان زینتی شهر شهرکرد که هر دو گروه دارای علائم مشکوک به سپتی­سمی آئروموناس‌های متحرک بوده­اند، نتایج زیر حاصل گردید. بعد از نمونه‌برداری از کبد و کلیه هر دو گروه ماهیان مورد بررسی و کشت در محیط آگار خون‌دار، بر روی پرگنه‌های رشد یافته سه تست اکسیداز، کاتالاز و رنگ‌آمیزی گرم انجام پذیرفت. این آزمون‌ها در تفریق اولیه باکتری آئروموناس هیدروفیلا مؤثر بوده و به واسطه آن می‌توان باکتری­های جنس آئروموناس را شناسایی و جدا نمود، اما برای تشخیص قطعی جدایه‌ها بایستی پس از کشت در محیط انتخابی ریملر شاتس یا بایستی آزمون‌های تکمیلی بیوشیمیایی و سرولوژیکی را انجام داد و یا این که از آزمایشات مولکولی مطمئن استفاده کرد که در این خصوص از PCR استفاده شد. لذا، جدایه‌هایی که گرم منفی، کاتالاز و اکسیداز مثبت بوده و در محیط ریملر شاتس نیز رشد کرده بودند، برای انجام آزمون PCR آماده‌سازی گردید. با انجام آزمایش مذکور مجموعاً 6 نمونه جدا شده از ماهیان زینتی و 9 نمونه از ماهیان قزل­آلا به عنوان نمونه مثبت آئروموناس هیدروفیلا تشخیص داده شد. بر این اساس از تعداد کل نمونه‌های ماهی قزل­آلای رنگین­کمان 15 درصد و از نمونه‌های ماهی قرمز 12 درصد آلوده به آئروموناس هیدروفیلا تشخیص داده شد.

 

 

 

 

شکل 1- تصویر ژل آگارز: ردیابی ژن lip  آئروموناس هیدروفیلا با تکنیک PCR، لاینM : مارکر100 جفت‌بازی، لاین 1: کنترل منفی، لاین 2 و 3 و 4،:  نمونه‌های مثبت آئروموناس هیدروفیلا

 


بحث و نتیجه‌گیری

   گونه‌های جنس آئروموناس جزء میکروب‌های غالب محیط زیست آب شیرین بوده و به همراه سایر میکروارگانیسم‌ها به صورت یک بیوفیلتر طبیعی و موثر در خود­پالایی آب عمل می‌کنند. گرچه این باکتری‌ها به‌طور طبیعی در میکروفلور آب و بدن ماهیان وجود دارند ولی گاهاً تحت شرایط خاص اعم از کاهش ایمنی بدن و وارد آمدن استرس به ماهیان با ایجاد تلفات بالا منجر به خسارات اقتصادی فراوان در آبزیان پرورشی می‌گردند. سپتی­سمی آئروموناس‌های متحرک یکی از بیماری‌های جدی و با گستردگی جهانی در گونه‌های مختلف آبزیان اعم از گونه‌های وحشی و پرورشی ماهیان و سخت­پوستان در انواع محیط‌های آب شیرین و دریایی است. عامل این بیماری یعنی آئروموناس هیدروفیلا به عنوان یک پاتوژن فرصت­طلب در آبزیان و موجودات خاک­زی و انسان تلقی شده و موجب بروز عوارضی هم‌چون اسهال خونی، مننژیت و سپتی­سمی خفیف تا شدید می‌گردد. البته این ضایعات هنگامی بروز می‌کند که ماهی به شکل خام یا نیم­پز مصرف شود. این باکتری از ماهیان زیادی هم‌چون کپور معمولی، قزل­آلای رنگین­کمان، گربه­ماهی روگاهی، تیلاپیا و تاس­ماهی سفید جدا شده است. آئروموناس هیدروفیلا باعث ایجاد آب آوردگی عفونی در ماهیان خوراکی و زینتی می‌گردد. بیماری‌زایی این باکتری در اثر برخی سموم اعم از سیتوتوکسین، پروتئاز، لایه اس باکتری، آئرولیزین و همولیزین صورت می‌گیرد. حضور این قبیل عوامل حدت نشان از خطر بالقوه باکتری مذکور و ایجاد ضایعات در بافت‌های مختلف بدن دارد.

   نتیجه تحقیق حاضر به ردیابی و شناسایی باکتری آئروموناس هیدروفیلا در ماهیان قرمز آکواریومی و قزل­آلای رنگین­کمان پرورشی منجر گردید. از آنجائی که استان چهارمحال و بختیاری به عنوان قطب تولید ماهیان سردابی معرفی شده و این تولید همچنان با روند افزایشی همراه است و با توجه به گسترش مزارع پرورشی و کم شدن فاصله بین آنها احتمال بروز بیماری‌های عفونی از جمله بیماری‌های باکتریایی در این منطقه از کشور افزایش می‌یابد. در سال‌های اخیر شیوع بیماری‌هایی هم‌چون استرپتوکوکوزیس و یرسینیوزیس منجر به تلفات همه‌گیر و خسارات اقتصادی فراوان در ماهیان قزل­آلای رنگین­کمان کشور گردیده است که استان چهارمحال و بختیاری نیز از این قاعده مستثنا نبوده و گزارشات مختلفی از بروز بیماری‌های ذکر شده صورت گرفته است (Fadaeifard et al., 2011; Fadaeifard et al., 2014). در کپورماهیان نیز بروز سپتی­سمی آئروموناس‌های متحرک از بیماری‌های شایع به شمار رفته و از آنجائی که ماهیان زینتی به ویژه ماهی قرمز به عنوان گسترده‌ترین ماهیان آکواریومی کشور نیز در تهدید ابتلا به این بیماری قرار دارند، متاسفانه در برخی موارد با رهاسازی این ماهیان در محیط‌های طبیعی هم‌چون رودخانه‌ها و تالاب‌ها احتمال انتقال بیماری بین این ماهیان و ماهیان رودخانه‌ای افزایش یافته و از نظر زیست محیطی و بیماری شناختی می‌تواند تهدیدی جدی برای ماهیان پرورشی به شمار آید. در خصوص جداسازی و شناسایی آئروموناس هیدروفیلا می‌توان به گزارشات متعدد محققین کشورمان اشاره نمود (رضویلر و همکاران  1360 ؛ ربانی و سلطانی، 1378؛ اخلاقی، 1377؛ هادی و همکاران،1391؛ شاهسونی و راد، 1378؛ اسماعیلی و پیغان، 1378). در سایر نقاط دنیا نیز، حضور این باکتری و هم‌چنین بیماریزایی آن در ماهیان مختلف مورد مطالعه گرفته است، به‌طوری که در سال 2010 خسارت وارد به صنعت پرورش ماهی علف­خوار که یکی از مهمترین ماهیان تجاری چین به شمار می‌رود در نتیجه بیماری‌ها و تلفات ناشی از آئروموناس‌ها به 3/0 بیلیون دلار بالغ گردید (Jang et al, 2010). در ادامه و طی بررسی بر روی این ماهی چهار سویه حاد قوی آئروموناس هیدروفیلا به همراه 5 ژن حدت از آنها مورد شناسایی قرار گرفت (Zheng et al., 2012). هم‌چنین علت تلفات کپور معمولی پرورشی اطراف بغداد در کشور عراق، سویه آئروموناس هیدروفیلا اعلام گردید (Alsaphar and Al-Faragi, 2012). با مطالعه و بررسی تلفات ماهیان تیلاپیای پرورشی (Oreochromis niloticus) مصر میزان شیوع سپتی­سمی آئروموناس­های متحرک 3/47 درصد اعلام شد و تأکید گردید که تیلاپیا حساس‌ترین ماهی نسبت به این بیماری است (Ahmed and Ashram , 2002). با توجه به مطالب گفته شده مشخص گردید که این باکتری دارای ویژگی مهمی از بابت بروز بیماری در ماهیان مختلف آب شیرین بوده و لذا می­توان از آن به عنوان عامل مشترک در بروز سپتی­سمی‌ها و تلفات ماهیان پرورشی سردابی و گرمابی نام برد. در حال حاضر جهت شناسایی آئروموناس هیدروفیلا از تکنیک‌های مختلفی نظیر آزمایشات بیوشیمیایی و فیزیولوژیکی، PCR، تکثیر تصادفی DNA چند­شکلی، برش عرضی پلاسمید و الکتروفورز پروتئین‌های تام، غشایی و خارج سلولی استفاده می‌شود (Lee et al.,2013)، که می‌توان به ردیابی ژن آئرولیزین و همولیزین به­وسیله تست PCR از باکتری آئروموناس هیدروفیلای جداسازی شده از ماهی آلوده کپور کویی (Koi carp) اشاره کرد. انتقال عامل بیماری‌زای باکتریایی با این قبیل عوامل حدت از طریق تماس انسان با ماهی آلوده حین بررسی آنها یا بررسی آب یا سایر ترکیبات محیط زندگی ماهی از خطرات سلامتی برای انسان به شمار می‌رود. ماهی کپور معمولی و کویی به ترتیب از گونه‌های  معروف خوراکی و زینتی کپور ماهیان به شمار می‌روند که به آلودگی ناشی از این باکتری حساس هستند (Lewbart et al., 2001). هم‌چنین در شناسایی سویه‌های مختلف باکتری آئروموناس هیدروفیلای جدا شده از نمونه‌های آب، از روش‌های گوناگونی اعم از آزمایشات بیوشیمیایی و فیزیولوژیکی و آنالیزPCR-RFLP   به ‌وسیله پرایمرهای  16S rRNA استفاده گردیده است (Abulhamd, 2009). از روش‌های تشخیصی دیگری هم‌چون تکنیک‌های انگشت‌نگاری DNA  بوسیله PCR نیز بهره گرفته شده است که در تعیین ژنوتیپ 8 نمونه طبیعی و محیطی باکتری مورد ارزیابی قرار گرفت. مزیت روش انگشت‌نگاری بر مبنای PCR این است که توالی‌های متعدد که box element نیز نامیده می‌شود بین ژنوم گونه‌های ناهمگون باکتریایی پخش می‌شوند. این یافته‌ها می‌تواند برای تحقیق در مورد میزان اختصاصی بودن اثر انگشت گونه‌های آئروموناس هیدروفیلا به‌عنوان نشانگرهای بالقوه ژنوتیپی سودمند باشد (Singh et al., 2010).

   با توجه به نقش مهم این باکتری در بیماری‌زایی و بروز تلفات در ماهیان به ویژه انواع گرمابی از آن‌جائی که یکی از ماهیان مهم آکواریومی در کشور ما ماهی قرمز است و به دلیل پائین بودن قیمت آن در مقایسه با سایر ماهیان زینتی در اکثر مناطق از آن استفاده می­شود، اهمیت بروز عفونت‌های با عامل آئروموناس هیدروفیلا در این گونه ماهیان به دلیل گسترش آن در بین آکواریوم‌های خانگی و احتمال انتقال آن از طریق رهاسازی این ماهیان در منابع آبی مرتبط با مزارع پرورش قزل­آلای رنگین­کمان بسیار بالاست و لزوم توجه هر چه بیشتر مسؤلین ذیربط در زمینه کنترل و جلوگیری از بروز چنین وقایعی می‌باشد. با عنایت به گسترش آبزی‌پروری در کشورمان به ویژه استان چهار محال و بختیاری، در کنار سایر گونه‌های باکتری­های بیماری‌زا بایستی توجه لازم به آئروموناس هیدروفیلا و بروز احتمالی ضایعات و تلفات ناشی از آن را در هر دو گروه ماهیان قزل­آلای رنگین­کمان و ماهی قرمز آکواریومی را مبذول داشته و نسبت به رعایت اصول و مدیریت بهداشتی اقدامات  لازم را به‌عمل آورد. عموماً محیط زیست آبزی، تماس ثانویه در هنگام صید، انتقال، جابجایی از منابع پیدایش و انتشار باکتری به شمار می‌روند. اعمال مدیریت مناسب مزرعه‌ای از جمله حفظ کیفیت آب پرورشی، مدیریت مناسب غذایی و بهداشتی، اعمال شرایط قرنطینه‌ای و استفاده از آنتی‌بیوتیک‌های توصیه شده در سطح مناسب جهت کنترل بیماری می‌تواند در پیشگیری و کنترل عفونت‌های ناشی از آئروموناس هیدروفیلا در ماهیان و هم‌چنین عدم سرایت آن به انسان کمک نماید.

  • اخلاقی، م. (1377). برخی فاکتورهای استرس‌زا در ظهور عفونت‌های ناشی از آئوموناس هیدروفیلا (Aeromonas hydrophila) در کپور ماهیان پرورشی، مجله علمی شیلات ایران، سال 7، شماره 4، صفحات: 8-1.
  • اسماعیلی، ف. و پیغان، ر. (1376). آلودگی ماهی کپور علفخوار به ارگانیسم‌های شبیه آئرووناس‌های متحرک. مجله علمی شیلات ایران، سال 6، صفحات: 8-1.
  • شاهسونی، د. و راد، م. (1378). گزراش سپتی سمی آئروموناس هیدورفیلا در ماهی اسکار آکواریومی، Astronotus ocellatus. مجله دامپزشکی ایران، دوره 2، شماره 3، صفحات: 70 - 69.
  • ربانی خوراسگانی، م. و سلطانی، م. (1378). ارزیابی تکنیک آنتی‌بادی درخشان به روش غیرمستقیم برای تشخیص ویبریو آنگوئیلاروم (Vibrio anguillarum) و آئروموناس هیدروفیلا (Aeromonas hydrophila) در کارگاه‌های پرورش ماهی و میگو. مجله دانشکده دامپزشکی دانشگاه تهران، دوره 54، شماره 2، صفحات: 87-73.
  • رضویلر، و.، حسنی طباطبایی، ع. و آذری تاکامی، ق. (1360). بررسی و نقش بیماری‌زایی آئروموناس هیدروفیلا در بعضی بیماری‌های ماهی. مجله دانشکده دامپزشکی دانشگاه تهران، دوره 3، شماره 3، صفحات: 33-21.
  • هادی، ف.، قاسمی، م.، سائزی‌قاسمی، م.، عیسی‌زاده، ک.، حقیقی، س. و خارا، ح. (1391). شناسایی مولکولی آئروموناس هیدروفیلا Aeromonas hydrophila جدا شده از ماهی کپور نقره‌ای،  Hypophthalmichthys molitrix. دومین کنگره ملی علوم آزمایشگاهی دامپزشکی، 22 تا 23 آذر ماه، دانشگاه سمنان.
    • Abulhamd, A.T. (2009). Characterization of Aeromonas hydrophila Isolated from Aquatic Environments Using Phenotypic and Genotyping Methods. Research Journal of Agriculture and Biological Science, 5(6): 923-931.
    • Ahmed, M. and El-Ashram, M. (2002). On Aeromonas hydrophila Infection among cultured tilapias: A biological, histopathological and management study. Egyptian Journal of Aquatic Biolology and Fishery, 6(3): 181-202.
    • Alsaphar, S.A.A. and Al-Faragi, J.K.H. (2012). Detection and study of the experimental infection of Aeromonas strain in the common carp (Cyprinus carpio L.). The Iraqi Journal of Veterinary Medicine, 36 (2):222-230.
    • Cascon, A., Anguita, J., Hernanz, C., Sanchez, M., Fernandez, M. and Navarro, G. (1996). Identification of Aeromonas hydrophila Hybridization Group 1 by PCR Assays, Applied and Environmental Microbiology, 62(4): 1167-1170.
    • Chang, C.I., Hung, P.H., Wu, C.C., Cheng, T.C., Tsai, J.M., Lin, K.J., et al. (2012). Simultaneous Detection of Multiple Fish Pathogens Using a Naked-Eye Readable DNA Microarray. Sensors, 12(3): 2710-2728.
    • Choresca Jr, C.H., Gomez, D.K., Han, J., Shin, S., Kim, J., Jun, J., et al. (2010).  Molecular detection of Aeromonas hydrophila isolated from albino catfish, Clarias sp. reared in an indoor commercial aquarium. Korean Journal of Veterinary Research, 50(4): 331-333.
    • Fadaeifard, F., Momtaz, H., Rahimi, E. and Mirzakhani, A. (2011). Detection of Streptococcus iniae and Lactococcus garvieae by multiplex polymerase chain reaction in some rainbow trout farms of Iran. African Journal of Biotechnology, 11(2): 260-263.
    • Fadaeifard, F., Sharifzadeh, A., Raisi, M., Mazrooi, H., Safari, S. and Moumeni, M. (2014). Molecular identification of Yersinia ruckeri isolates by polymerase chain reaction test in rainbow trout, Oncorhynchus mykiss. European Journal of Experimental Biology, 4(1): 1-4.
    • Jang, S., Liu, H., Su, J., Dong, F., Xiong, F., Liao, L., et al. (2010). Construction and characterization of two bacterial artificial chromosome libraries of grass carp. Marine Biotechnology, 12: 261-266.
    • Lee, S., Kim, S., Oh, Y. and Lee, Y. (2000). Characterization of Aeromonas hydrophila isolated from rainbow trout. Korea Journal of Microbiology, 38(1): 1-7.
    • Lewbart, G.A. (2001). Bacteria and ornamental fish. Seminars in Avian and Exotic Pet Medicine, 10: 48-56.
    • Shotts, E.B. Jr and Rimler, R. (1973). Medium for the isolation of Aeromonas hydrophila. Journal of Applied Microbiology, 26(4): 550-553.
    • Singh, V., Chaudhary, D.K., Mani, I., Somvanshi, P., Rathore, G. and Sood, N. (2010). Genotyping of Aeromonas hydrophila by Box Elements. Microbiology, 79(3): 370-373.
    • Uma, A., Rebecca, G., Meena, S. and Saravanabava, K. (2010).PCR detection of Putative aerolysin and hemolysin genes in an Aeromonas hydrophila isolate from infected Koi Carp (Cyprinus Carpio). Tamilnadu Journal of Veterinary and Animal Science, 6(1): 31-33.
    • Wang, G., Clark, C.G., Lium, C., Pucknell, C., Munro, C.K., Kruk, T.M.A.C., et al. (2003). Detection and characterization of the hemolysis genes in Aeromonas hydrophila and Aeromonas sobria by multiplex PCR. Journal of Clinical Microbiology, 41: 1048-1054.
    • Wang, Y., Tang, C., Yu, X., Wang, Y. and Yue, H. (2008), Detecting pathogenic Aeromonas hydrophila in fish by triplex PCR. Wei Sheng Wu Xue Bao (Chinese journal), 48(7): 947-951.
    • Zheng, W., Cao, H. and Yang, X. (2012). Grass carp (Ctenopharyngodon idellus) infected with multiple strains of Aeromonas hydrophila. African Journal of Microbiology Research, 6(21): 4512-4520.