آنالیز فیلوژنتیک مایکوباکتریوم آویوم تحت‌گونه‌ پاراتوبرکلوزیس جدا شده از گاوداری‌های استان تهران

نوع مقاله: علمی پژوهشی

نویسندگان

1 دانش‌آموخته، گروه میکروبیولوژی، دانشکده دامپزشکی، واحد علوم و تحقیقات، دانشگاه آزاد اسلامی، تهران، ایران.

2 استاد، گروه میکروبیولوژی، دانشکده دامپزشکی، واحد علوم و تحقیقات، دانشگاه آزاد اسلامی، تهران، ایران.

3 استادیار، گروه میکروبیولوژی، دانشکده دامپزشکی، واحد کرج، دانشگاه آزاد اسلامی،کرج، ایران.

چکیده

بیماری یون یا پاراتوبرکلوزیس نوعی التهاب روده شدید، مزمن و پیش­رونده در نشخوارکنندگان با عامل مسبب مایکوباکتریوم آویوم تحت­گونه­ پاراتوبرکلوزیس می­باشد که خسارات اقتصادی فراوانی به صنعت دامپروری به­ویژه گاوداری­های شیری وارد می­کند. از سوی دیگر آن را عامل ایجاد­کننده بیماری کرون در انسان می­شناسند. این مطالعه با هدف آنالیز فیلوژنتیک مایکوباکتریوم پاراتوبرکلوزیس جداشده از گاوداری­های استان تهران انجام گردید. در این مطالعه از تعداد 100 نمونه مدفوع گاوهای مشکوک به بیماری یون، استخراج DNAانجام شد سپس با استفاده از پرایمرهای اختصاصی ژن IS900واکنش Nested PCRصورت گرفت و از موارد مثبت جدا شده، 14 نمونه به­طور تصادفی برای توالی­یابی به شرکت ماکروژن کره ارسال گردید. در این مطالعه در مجموع 28 نمونه از 100 نمونه مدفوعی از نظر وجود باکتری مایکوباکتریوم آویوم تحت­گونه­ پاراتوبرکلوزیس مثبت بود. بعد از توالی­یابی نمونه‌های مثبت ملاحظه گردید که بیش از 99 درصد با توالی­های موجود در بانک ژن شباهت وجود دارد. همچنین نتایج مطالعه حاضر نشان داد که سویه­های  KJ629114 وAE016958  بیشترین شباهت و سویه CP000325  بیشترین تفاوت را با جدایه­های حاصل از این مطالعه در ژن GyrAدارند. در مورد ژن  GyrBنیز بیشترین شباهت مربوط به سویه­های AE016985 ،CP005928  وCP009614 و بیشترین تفاوت هم مربوط به سویه GU143884می­باشد. نتایج مطالعه نشان داد که تکنیک Nested PCRمی­تواند روش ارزشمندی برای شناسایی مایکوباکتریوم آویوم تحت­گونه­ پاراتوبرکلوزیس در حیوانات باشد. 

کلیدواژه‌ها


عنوان مقاله [English]

Phylogenetic analysis of Mycobacterium avium subspecies paratuberculosis isolated from dairy cattle of Tehran province

نویسندگان [English]

  • behboud jafari 1
  • mahmoud jamshidian 2
  • farhad mousakhani 3
چکیده [English]

   Paratuberculosis or Johne's disease is a severe chronic and progressive intestinal inflammation in ruminants caused by Mycobacterium avium subspecies paratuberculosis which can lead to great economic losses to the livestock industry especially dairy idustry. On the other hand, it is known as a zoonosis in the pathogenesis of Crohn's disease in humans. This study was conducted with the purpose of phylogenetic analysis of Mycobacterium avium par tuberculosis isolated from dairies in Tehran.
In this study, DNA extraction was performed on 100 stool samples from Johne's disease infected cattle. Then using specific primers of gene IS900, Nested PCR reactions was carried out and from the positive samples isolated, 14 cases were randomly selected and sent to Macro gene Company in Korea for sequencing. In this study, 28 samples from a total of 100 stool samples were positive for MAP. After sequencing, more than 99% of the positive samples were similar with sequences in gene bank. The Results showed that Nested PCR technique can be a valuable test for detection of Mycobacterium avium paratuberculosis in animals. The sequencing results indicated that strains KJ629114 and AE016958 had the highest similarity and CP000325 had the highest difference in GyrA gene. In regard to GyrB gene, the highest similarity belongs to strains AE016985, CP005928 and CP009614 and the highest difference was related to GU143884.

کلیدواژه‌ها [English]

  • Mycobacterium avium subspecies paratuberculosis
  • phylogenetic analysis
  • Tehran

مقدمه

   بیماری یون یا پاراتوبرکلوزیس یک بیماری مسری و از عفونت­های مزمن نشخوارکنندگان می­باشد که از لحاظ همه‌گیری در رده B تقسیم­بندی سازمان جهانی حیوانات قرار گرفته ­است (Vasnick et al., 2005). این بیماری از جنبه شیوع گسترده­ترین و از لحاظ اقتصادی از مهم­ترین بیماری­ها در صنعت دامپروری محسوب می­شود (Douarre et al., 2010). عامل بیماری باسیلی است که در راسته اکتینومایستال و در خانواده مایکوباکتریاسه و جنس مایکوباکتریوم به نام Mycobacterium avium subspecies paratuberculosis یا به اختصارMAP قرار دارد (Jagdeep et al., 2009; Alexander et al., 2009). وجود دیواره­های غنی از لیپید، مایکوباکتریوم­ها را به‌صورت باکتری­های آب‌گریز (هیدروفوب) درآورده و نسبت به عوامل محیطی مقاوم می­نماید. مایکوباکتریوم‌های محیطی در خاک روی نباتات و در آب یافت می­شوند. مایکوباکتریوم­های بیماری­زای اجباری توسط حیوانات مبتلا دفع می­شوند و هم­چنین می­توانند در محیط برای مدتی طولانی باقی بمانند (Quinn, 2002). تکثیر جرم در مخاط باعث تحریک پاسخ گرانولوماتوزی در ناحیه ایلئوم شده و سپس ناحیه سکوم و انتهای قولون درگیر می­شود و در موارد پیشرفته بیماری، ضایعات در سراسر روده و عقده­های لنفاوی ناحیه­ای مشاهده می­شود. هم­چنین از علائم بارز مشاهده شده در کالبدگشایی دام­های مبتلا به بیماری مذکور می توان ضخیم شدن دیواره روده به میزان 3 تا 4 برابر ضخامت طبیعی همراه با چین­خوردگی مخاط آن اشاره نمود که ناشی از افزایش سلول­های اپی­تلیوئیدی در لایه­های زیرین مخاط می­باشد (حسنی طباطبایی و فیروزی، 1380; De Meneghi etal., 2006). بیماری یون در ایران برای اولین بار در سال 1340-1339 توسط خلیلی و طلاچیان شناسایی شد آن­ها عامل بیماری را از مدفوع گاوهای نژاد جرسی وارداتی شرکت نفت آبادان جدا کردند و منشا عفونت را دام­های وارداتی گزارش نمودند. پس از آن­ها مقامی و هدایتی در سال 1340 این بیماری را در یک راس گاو هلشتاین گزارش کردند (حسنی طباطبایی و فیروزی، 1380). کاهش تولید، افزایش حساسیت به سایر بیماری­ها، از دست رفتن ارزش ژنتیکی، حذف پیش از موعد، افزایش فاصله بین گوساله­زایی از پیامدهای اقتصادی این بیماری است. هم­چنین بیماری مذکور به علت تاثیر روی ترکیبات شیر باعث کاهش چربی، پروتئین و افزایش سلول­های سوماتیک در آن می­شود. به­طوری­که، در مطالعه­ای کاهش تولید شیر بین 58/1 تا 2/7 کیلوگرم در روز بوده است. هم‌چنین با توجه به این­که دوره کمون بیماری یون در گاو بسیار طولانی است و در طی این زمان حیوانات آلوده قادرند که تعداد زیادی از باکتری عامل این بیماری را دفع کرده و موجب آلودگی محیط شوند بنابراین کنترل بیماری یون بدون در نظر گرفتن آزمونی که بتواند ناقلین بدون علائم بالینی بیماری مذکور (تحت بالینی) را شناسایی کند امکان­پذیر نیست (Beaudeau et al., 2007).

   از طرف دیگر یکی از جنبه­های مورد توجه در مورد MAP ارتباط احتمالی آن با بیماری کرون (Crohn's Disease) است که یک بیماری مزمن و مشابه یون در انسان می­باشد که با توجه به جداسازی باکتری مذکور از بافت­ روده­ برخی بیماران مبتلا به بیماری کرون تصور می­شود که یکی از عوامل  دخیل در ایجاد بیماری مذکور باکتری MAP باشد (Verlain etal., 2011; Elena et al., 2012). عده­ای از محققان نیز بیان می­کنند که حتی ممکن است بعد از پاستوریزاسیون شیر نیز این جرم بیماری­زا در شیر زنده باقی بماند و از این طریق به عنوان یک عامل تهدیدکننده سلامتی در سطح جامعه مطرح بشود. عقیده بر این است که می­تواند از طریق شیر خام و پاستوریزه و هم­چنین گوشت و محیط به عنوان یک منبع فرعی، در معرض مایکوباکتریوم پاراتوبرکلوزیس قرار گیرد (Donaghy et al., 2008). از زمان شناسایی MAP گستره زیادی از روش­ها برای شناسایی آن در حیوانات آلوده به کار رفته­است که شامل تشخیص سنتی بر اساس علائم بالینی، استفاده از روش­های ایمنی­سنجی نظیر  ELISA(Jorgensen and Jensen, 1978) و روش­های مولکولی مرتبط با PCR مانند PCR ساده (Vary et al.,1990)،  PCR آشیانه­ای (Stable et al., 2002) و Real–Time PCR (O'mahony and Hill, 2004) و روش کمی Real–Time (Slana et al., 2008) می­باشد. هم­چنین روش RFLP همراه با روش PCR یا به اختصار PCR-REA نیز از مدت­ها قبل برای این کار پیشنهاد شده­است (Eriks et al., 1996). حتی بدین منظور در یک گزارش استفاده از روش سلول­سنجی فاز جامد استفاده و بهینه­سازی شده است (D' Haese et al., 2005). البته باید توجه داشت که هنوز هم روش کشت سلولی به عنوان روش اصلی در آزمایشگاه­ها به منظور تشخیص MAP مورد استفاده قرار می­گیرد (Douarre et al., 2010) در بین روش­های مذکور روش­های مبتنی بر PCR به لحاظ سرعت بالا، هزینه کم و حساسیت زیاد جایگاه ویژه­ای دارند. امروزه بیشتر روش­هایی که از PCR برای تشخیص MAP بهره می­برند مبتنی بر شناسایی قطعه DNA درون جایگیر IS900 هستند (Slana et al., 2008). هدف از انجام این مطالعه آنالیز فیلوژنتیک مایکوباکتریوم آویوم تحت­گونه­ پاراتوبرکلوزیس جدا شده از گاوداری­های استان تهران می­باشد.

 

مواد و روش‌ها

   این مطالعه به صورت توصیفی–مقطعی روی 100 نمونه مدفوع گاوهای مشکوک به بیماری یون (واجد علائم بالینی) در استان تهران انجام شد. برای استخراج DNA از کیت استخراج DNA ساخت شرکت سیناژن (DNA Purification DNP TMKIT) استفاده شد و DNAهای استخراج شده تا زمان انجام PCR در فریزر 20-درجه سلسیوس نگه­داری شدند. البته با توجه به غلظت بالای عوامل بازدارنده­ PCR در مدفوع، قبل از استخراج DNA نمونه­ها به نسبت 1 به 50 رقیق­سازی شدند. برای انجام آزمایش Nested PCR از جفت پرایمرهای طراحی شده  برای شناسایی ژن IS900 به روش دی منگی در سال 2005 استفاده شد (De Meneghi et al., 2006). در تمامی آزمایشات PCR از شاهد مثبت و منفی استفاده گردید. نمونه­ای از MAP که قبلاً با IS900 توالی­یابی و تایید شده ­بود، به عنوان کنترل مثبت استفاده شد. کنترل منفی دارای کلیه واکنش­گرهای PCR به جز DNA الگو بود که هم حجم آن آب مقطر اضافه شد.

 PCR مرحله اول: برای انجام مرحله اول PCR از پرایمرهای

S1:   5'-GGGTTGATCTGGACAATGACGGTTA-3'     572 bp

R3:  5'-AGCGCGGCACGGCTCTTGTT-3'

استفاده شد که محصول جفت پرایمر مذکور پس از انجام آزمایش PCR قطعه­ای به اندازه bp 572 می­باشد و واکنش­گرهای مربوط به PCR مرحله اول در حجم نهایی 25 میکرولیتر باهم مخلوط گردیدند. این مخلوط شامل 5/2 میکرولیتر از DNAی الگو، 2/0 میکرومول از هر پرایمر، 200 میکرومول dNTPMix، 5/1 میکرومول MgCl2 و 5/2 میکرولیتر بافر PCR و 5/2 واحد از آنزیم Tag DNA Polymerase بود که همگی از شرکت سیناژن ایران تهیه شده بودند. واکنش­گرهای PCR روی یخ مخلوط گردیده و بلافاصله نمونه­ها در دستگاه ترموسایکلر (Mastercycler Gradient, Eppendorf, Germany) قرار گرفته سپس برنامه­ی حرارتی مورد استفاده شامل: 94 درجه سلسیوس 5 دقیقه، سپس 35 چرخه دمایی به ترتیب 94 درجه سلسیوس 30 ثانیه، 55 درجه سلسیوس 30 ثانیه و 72 درجه سلسیوس 30 ثانیه و یک مرحله نهایی 72 درجه سلسیوس 7 دقیقه تنظیم گردید (De Meneghi et al., 2006).

PCR مرحله دوم: برای انجام مرحله دوم PCR از پرایمرهای

S2:   5'-GGAGGTGGTTGTGGCACAACCTGT-3'      432 bp

R1:  5'-CGATCAGCCACCAGATCGGAA-3'

   استفاده شد که محصول جفت پرایمر مذکور پس از انجام آزمایش PCR قطعه­ای به اندازه bp 432 می­باشد. در این مرحله همه شرایط مانند مخلوط واکنش‌گرهای PCR و برنامه زمانی و دمایی مطابق مرحله اول بود با این تفاوت که DNA الگوی مورد استفاده شامل 5/2 میکرولیتر از محصول PCR مرحله اول بود که به نسبت 1 به 100 رقیق و به مخلوط واکنش اضافه گردید. سپس با انجام الکتروفورز با ژل آگارز 5/1 درصد توسط اتیدیوم برماید رنگ­آمیزی شد و با استفاده از نور UV مورد ارزیابی قرار گرفت. نمونه­های حاصل از استخراج از روی ژل، همراه با پرایمرهای مربوط جهت تعیین توالی نوکلئوتیدی به شرکت ماکروژن کره ارسال گردید. ابتدا نوکلئوتیدهای قطعه مربوطه از ژن IS900  که مسئول کد کردن پروتئین فرضی Transposase  می­باشد به­وسیله تطبیق توالی نوکلئوتیدی دو رشته Forward و  Reverse و توالی پرایمرهای مورد استفاده، به دست آمد (2012 et al., Franck). توالی­های به­دست آمده در بانک ژن ثبت و با انجام آزمون BLAST به وسیله نرم­افزارهای Bioedit و DNAstar آنالیز فیلوژنتیک انجام شد و با یافته­های سایر کشورها مقایسه و نتایج تحلیل و تفسیر گردید.

GyrA locus 34 Primer

 F: TGTTCTTCACCACCCAGGGCCGGG                   443bp   R:TTGAGCGACAGCAGGTAGTCGTCGGCG     

GyrB locus 45 Primer

 F: TTGGTGCGCCGCAAGAGCGCAACCG       417bp          R:ATTTCAGCTTGTACAGCGGTGGC

 

یافته­ها

   کیفیت DNAهای استخراج شده پس از الکتروفورز روی ژل آگارز مشاهده و مورد تایید قرار گرفت و برای انجام Nested-PCR مناسب تشخیص داده­ شد. از 100 نمونه مورد مطالعه با روشPCR ، 28 نمونه مثبت شد و از آن 14 نمونه به توالی­یابی ارسال گردید (شکل 1).

 

 

 

شکل 1- نتایج حاصل از Nested PCR برای تشخیص  MAPشماره‌های 1 و 2 نمونه‌های آلوده و شماره‌های 3 کنترل مثبت و 4 کنترل منفی می‌باشد (مارکر bp50 شرکت فرمانتاز)

 


بررسی و مقایسه توالی نوکلئوتیدی و آنالیز فیلوژنتیکی

   نتیجه توالی­یابی­ها پس از بلاست در دیتابانک NCBI با یکدیگر و جدایه­های موجود در Gene Bank مقایسه شد و توالی­های به­دست آمده با استفاده از نرم­افزار Bioedit و DNAstar آنالیز فیلوژنتیک انجام شد. پس از Alignment توالی مورد هدف با دیگر توالی­های ثبت شده در NCBI ترسیم درخت شباهت به صورت زیر انجام شد (شکل­های 3 و 2).  توالی­های به­دست آمده با توالی­های ثبت شده در NCBI بالای 99 درصد شباهت را نشان داد (جداول 1 و 2).

 

 

 

شکل 2- درخت فیلوژنتیکی جدایه­های مورد مطالعه ژن  GyrAدر مقایسه          شکل 3- درخت فیلوژنتیکی جدایه­های مورد مطالعه ژن  GyrB

با جدایه­های سایر نقاط مختلف جهان بر اساس توالی نوکلئوتیدی                      با جدایه­های سایر نقاط مختلف جهان بر اساس توالی نوکلئوتیدی

 

 

 

 

 

 

جدول 1- در صد شباهت­ها و تفاوت­های موجود در توالی­های                                جدول 2- درصد شباهت‌ها و تفاوت­های موجود در توالی­های

جدا شده ژنGyrA  با جدایه­های سایر نقاط مختلف جهان                           جدا شده ژن GyrB  با جدایه­های سایر نقاط مختلف جهان

       
       

 

 

 

 

 

 

 

 

 

 


بحث و نتیجه‌گیری

   موفقیت برنامه­های کنترل بیماری یون به وجود یک روش تشخیصی سریع و دقیق نیاز دارد که به­وسیله آن بتوان حیوانات ناقل این عامل عفونی را تشخیص و کنترل نمود. با وجود ابداع روش­های گوناگون تشخیص مایکوباکتریوم پاراتوبرکلوزیس در حیوانات، به کارگیری بسیاری از این تکنیک­ها مستلزم صرف وقت و هزینه‌های گزافی می­باشد. با کشف واکنش زنجیره­ای پلیمراز محققان نسبت به کاربرد این روش ارزشمند در تشخیص عوامل عفونی به ویژه میکروارگانیسم­های غیرقابل کشت و یا دیررشد تشویق شدند. بیماری یون یک بیماری روده­ای گرانولوماتوز و مزمن است که در طیف وسیعی از نشخوار­کنندگان ممکن است ایجاد شود. این بیماری غالباً به صورت دهانی– مدفوعی و هم­چنین از طریق شیر و جفت آلوده انتقال می­یابد (2005 et al., Berghaus) و به علت بیماری­زایی مشترک بین انسان و حیوان و خسارت ناشی از کاهش تولید در گله­های درگیر از اهمیت زیادی برخوردار می‌باشد. ژنوم این باکتری از حدود 5 میلیون جفت باز در یک کروموزوم حلقوی با بیش از 4500 ژن تشکیل شده ­است و طول متوسط هر ژن در آن 1015 جفت باز می­باشد. ژن­های بیماری­زای مرتبط با این باکتری شامل hspx، F57 و IS900 هستند که ما در این تحقیق از توالی درون جایگیر IS900 برای شناسایی پاراتوبرکلوزیس استفاده کردیم. به منظور حصول اطمینان از وجود DNA باکتریMAP  درنمونه­ها با کمک پرایمرهای تحت­ژنوتیپ­های ژن­های  GyrBو GyrA مجدداً برای افزایش دقت شناسایی پی­سی­آر شدند. نتایج حاصل از این مقایسه قرابت بیش از 99 درصدی جدایه­ها را تایید نمود. البته توالی سکانس شده از ژن IS900 مربوط به MAP می­باشد که یک ژن حفاظت شده است. دلیل انتخاب این ژن کسب اطمینان صد­درصدی از MAP بودن جدایه­ها و عدم وجود خطا در مراحل مختلف آزمایش بود. هم­چنین باکتری مایکوباکتریوم آویوم تحت­گونه­ پاراتوبرکلوزیس دارای ژن­های  GyrAو  GyrB می‌باشد.  AوB دو تحت­واحد آنزیم DNA Gyrase می­باشند که از طریق هیدرولیزATP  منجر به باز­شدن مولکول  DNA(کاهش فشار داخلی DNA  از طریق تبدیل سوپرکویل­های منفی و مثبت به حالت استراحت) می­شود که در ضمن این عملکرد میزان  Linking number (عدد پیچش) را به مقدار دو عدد تغییر می­دهد. در این مطالعه با پرایمرهای اختصاصی ژن­های مذکور توانستیم آنالیزفیلوژنتیک مایکوباکتریوم آویوم تحت­گونه­ پاراتوبرکلوزیس را انجام دهیم. نتایج تعیین توالی برای ژن GyrA نشان­داد که بین نمونه­ها تفاوت نوکلئوتیدی وجود ندارد. به عبارتی، با توجه به دندروگرام ژن GyrA مشخص گردید که جدایه­های حاصل از تحقیق حاضر (10 جدایه GYRA1 الی (GYRA10 خویشاوندی نزدیک­تری (100%) نسبت به هم داشته و در یک کلاستر قرار گرفته­اند. برای تعیین وجود اختلاف نوکلئوتیدی با سایر نمونه­های گزارش شده از کشور اسپانیا جدایه­های (029115 EU) و (029113 EU) و کشور آمریکا جدایه (AE 016958) مورد مقایسه قرار گرفت. یافته­ها نشان داد که نتایج این تحقیق با نتایج گزارش شده از کشور آمریکا کاملاً مطابقت دارد و با نتایج گزارش شده با توجه به درختچه­ها از کشور اسپانیا به ترتیب برای جدایه­های  (029115 EU) و ((EU029113 8/99 و 5/99 درصد شباهت نشان می­دهد و تفاوت مشاهده­شده مربوط به تبدیل نوکلئوتیدی C"A در جایگاه شماره 118 در هر دو جدایه و تبدیل نوکلئوتیدی C"T در جایگاه شماره 282 در جدایه ((EU029113 می­باشد. جهت افزایش دقت برای رسم درخت فیلوژنیک از تعداد بیشتری نمونه­ استفاده گردید که ضمن تایید نتایج فوق، تطابق نتایج با گزارش قبلی از کشور ایران را نشان می­دهد طوری­که جدایه ((KJ629114 از کشور ایران با جدایه­های حاصل از تحقیق حاضر خویشاوندی نزدیک­ترو بیشتری دارد. علاوه­براین، نتایج حاصل از تحقیق حاضر با سایر نتایج گزارش شده در مورد MAP از سایر کشورها اختلاف را نشان می­دهد که این اختلافات در جدایه­های (CP009614)، ( AP012555)، (CP009499)، (CP002275)، (AY063753)، (CP000325)، (CP003899) و (FO203509) در درختچه فیلوژنتیکی (شکل 2) به­طور واضح مشاهده می­شود. نتایج مشابهی در مورد ژن GyrB نیز مشاهده گردید که جدایه­های به­دست­آمده از این تحقیق  (10 جدایه GYRB1 الی (GYRB10 بسیار مشابه هم بوده به­طوری­که، اختلافی بین نمونه‌های تعیین توالی­شده وجود ندارد. هم­چنین، با توجه به دندروگرام ژن GyrB نتایج به دست آمده ازتحقیق حاضر با جدایه  (016958 (AE از کشور آمریکا کاملاً مشابهت داشته ولی با جدایه های حاصل از کشور اسپانیا  (029112 (EU 8/99 درصد  و جدایه  (029114 (EU  5/99 درصد شباهت دارند (شکل 3)، که این تفاوت مربوط به تغییر نوکلئوتیدی T"C در توالی جایگاه شماره 74 در هر دو نمونه و تغییر نوکلئوتیدی C"T در جایگاه شماره 347 در نمونه (029114 EU) است. هم‌چنین با توجه به درختچه فیلوژنتیکی، جدایه­های حاصل از تحقیق حاضر با جدایه­های (CP009614) و (CP005928) خویشاوندی بیشتری دارد.

   با توجه به دندروگرام ژن GyrB سایر نمونه­های گزارش شده از سایر کشورها تفاوت بیشتری را نشان می­دهند که این تفاوت­ها در بخش نتایج (شکل 3) در نمونه­های (JQ582478)، (CP003324)، (GU143884)، (CP006936) و (CP002275) مشاهده می­شود. دلیل تفاوت­های مشاهده شده بین نمونه­ها ممکن است به دلیل تفاوت­های منطقه­ای باشد.

   بنابراین، با بررسی این تفاوت­ها و شباهت­ها مشخص شد که جدایه­های حاصل از ژن­هایGyrA  و GyrB با همدیگر کاملاً مطابقت داشته و مشابهت صددرصدی دارند. به طور کلی توالی­های به­دست آمده بیش از 99 درصد با توالی­های موجود در بانک ژنی (Gene Bank) شباهت داشت. جیمز و همکاران در سال 2011 در مطالعه ای نشان دادند که بین بیماری کرون در انسان و بیماری یون در حیوان شباهت­هایی وجود دارد است. هم‌چنین، با روش PCR از تعداد 30 نمونه MAP تایید کردند که VGI-17 و VGI-18 در ایزوله­های حاصل از این بیماری مشترک می­باشند (James etal., 2011). هم‌چنین فرانک و همکاران، در سال 2012 در مطالعه­ای مشخص کردند که با تکنیک­های IS900-RFLP و PFGE می­توان سویه­های MAP را به دو نوع بزرگ اغلب با نام گوسفندی (S-type) و یا گاوی (C-type) تقسیم کرد که این­ها دارای یک­سری تفاوت­ها و مشابهت­های ژنتیکی بین ایزوله­ها هستند (2012 et al., Franck). در سال 2012 تحقیقی که توسط جان و همکارانش صورت گرفت، نشان دادند که بین سویه­های مایکو باکتریوم آویوم پاراتوبرکلوزیس گاو و گوسفند ارتباط وجود داشته و این آنالیز می­تواند در تشخیص افتراقی فنوتیپی مختلف کمک کند (2012  John,).  سینگ و همکاران در مطالعه­ای در سال 2007 بررسی حساسیت Milk-ELISA و IS900 PCR مدفوعی و کشت مدفوع و کشت شیر در گوسفندها و بزها نشان دادند که حساسیت کشت مدفوع 6/84%، کشت شیر 1/96%،  Milk-ELISA4/88% و PCR مدفوعی 23% بود (2007 Singh,). ولز و همکاران، در بررسی دیگری برای تشخیص شیوع مایکوباکتریوم پاراتوبرکلوزیس توسط PCR مدفوعی و Milk-ELISA در 1808 نمونه در گاوهای شیری،PCR  مدفوعی 23% و Milk-ELISA 7/25% موارد مثبت را نشان دادند (2006 Wells,). در مطالعه دیگری که توسط حق‌خواه و همکارانش در سال 1387 در کشور ایران، در استان فارس، برای تعیین شیوع بیماری به وسیله PCR شیر بالک تانک انجام شد، از 110 گله در سه منطقه استان فارس (شیراز،‌ مرودشت و سپیدان) نمونه‌گیری انجام شد که از این تعداد 12 گله (11٪) بر اساس تست IS900-PCR  مثبت بوده‌اند. شیوع بیماری در مناطق مختلف تفاوتی از 6/8٪ تا 23٪ نشان می‌دهد. آمار پایین آلودگی گله‏ها در استان فارس با آمار به دست آمده در استان تهران در این تحقیق، تفاوت فاحشی دارد. البته در این مطالعه حجم نمونه شیر بالک تانک برای استخراج DNA، 5/0 میلی‌لیتر شیر بوده­است. استفاده از مقادیر پایین نمونه شانس جداسازی باکتری را کاهش می‌دهد (حق خواه و همکاران، 1387). در مطالعه‏ای که در سال 2002، استابل و همکارانش در 61 گله از 10 ایالت کشور آمریکا انجام داده‏اند، نتایج حاصل از الایزا و کشت مدفوع انفرادی گاوها را با نتایج حاصل از  PCR و کشت شیر بالک تانک گله‏ها، مورد مقایسه قرار داده‏اند. تمام گله‏های انتخاب شده، حداقل یک مورد گاو الایزا مثبت داشتند. از هرکدام از گله‌های تحت بررسی در این مطالعه، علاوه ­بر نمونه‌گیری شیر بالک تانک برای PCR،‌ متناسب با سایز گله تعدادی گاو انتخاب شده و از آن­ها کشت مدفوع به عمل آمد (در مجموع 712 گاو که به صورت اتفاقی از 61 گله انتخاب شده بودند). در این مطالعه 35 فارم (68%) در تست  IS900 Nested-PCR مثبت بودند. جالب توجه‌ اینکه 11 گله ( 4/52%) از گله‌هایی که هیچ مورد مثبتی در کشت مدفوع نداشتند،‌ در تست PCR مثبت بودند و بقیه موارد مثبت از 24 گله‌ای بود که حداقل 1 مورد کشت مثبت مدفوع داشتند. ولی در 7 گله که حداقل یک مورد کشت مثبت داشتند، جواب PCR شیر منفی بوده­است. هم‌چنین، 79% گله‏هایی که حداقل سه راس گاو الایزا مثبت داشتند، کشت شیر بالک تانک مثبت داشته‏اند. این درصد در گله‏هایی که یک یا دو رأس گاو الایزا مثبت داشته‏اند، برابر با 49% است. این محققان بر این نکته تاکید داشتند که حتی در گله‏های الایزا مثبتی که کشت مدفوع گاوها منفی می‏باشد، امکان آلودگی شیر به باکتری MAP وجود دارد (2002 et al., Stable). دوستی و مشکلانی در مطالعه­ای از تعداد 120 نمونه مدفوع گاوهای مشکوک به یون با استفاده از پرایمرهای اختصاصی ژن IS900 و آزمون Nested PCR مشخص کردند که از مجموع 120 نمونه مورد بررسی، 22 مورد (33/18%) به مایکوباکتریوم پاراتوبرکلوزیس آلوده بودند که در آزمون PCR مثبت تشخیص داده بودند (دوستی و مشکلانی، 1388) در مطالعه­ی دیگری سیدین و همکاران از دام­های با و بدون علائم بالینی یون به ترتیب 16 و 103 نمونه مدفوع را  با استفاده از روش Nested PCR و کشت در محیط­های هررولد فاقد مایکوباکتین جی  و یا دارای مایکوباکتین جی دریافتند که از میان نمونه­های مدفوع دارای علائم بالینی به ترتیب 3/81% درصد و15/87% به ترتیب با روش­های کشت و مولکولی مثبت شدند، در حالی که بررسی نمونه­های مدفوع دام‌های فاقد علائم بالینی نشان داد که  7/11% و 7/9% به ترتیب با روش­های کشت و مولکولی مثبت بودند (سیدین و همکاران، 1389). هم­چنین در تحقیق دیگری که توسط نصیری و همکاران انجام شد، از 243 نمونه مدفوع و 56 نمونه شیر خام از دام­های مشکوک گاوداری­های اطراف مشهد پس از استخراج DNA به منظور شناسایی نمونه‌های آلوده، تکثیر قطعه درون جای­گیر اختصاصی MAP به نام IS900 و جهت تعیین جدایه گاوی و گوسفندی MAP تکثیر قطعه درون جای­گیر IS1311 صورت گرفت، سپس قطعات حاصله به کمک آنزیم HinfI هضم شدند. در مطالعه ایشان مشخص گردید که تعداد 107 نمونه از 243 نمونه مدفوع (44%) و 10 نمونه از 56 نمونه شیرخام (18%) مورد مطالعه، آلوده به MAP بودند. هم­چنین، با هضم آنزیمی نشان دادند که تمامی MAPهای شناسایی شده از جدایه گاوی می‌باشند (نصیری و همکاران، 1391). در مطالعه­ دیگری دیلمقانی و همکاران از تعداد 400 رأس گاو در منطقه ارومیه، با استفاده از کشت مدفوع مشخص کردند که باکتری جدا شده MAP است و در بین نمونه­ها نتیجه کشت در 12% (48=n) مثبت و در بقیه موارد منفی بود (دیلمقانی و همکاران، 1390). شرافتی چالشتری و همکاران در تحقیقی از 100 نمونه شیر خام گاوهای گاوداری­های صنعتی و نیمه صنعتی شهرکرد با انجام روش PCR ، 3% را مثبت به­دست آوردند (شرافتی چالشتری و همکاران، 1388) برخی از مطالعات صورت­گرفته در سال­های اخیر نشان داده­است که روش PCR ساده و یک مرحله­ای در برخی از موارد قادر به تشخیص دقیق عامل عفونی مایکوباکتریوم پاراتوبرکلوزیس به­ویژه در شرایط مقدار کم DNA الگو نیست به همین دلیل، برای تشخیص این عامل عفونی در این تحقیق از روش مطمئن­تر و حساس­تر Nested-PCR به دلیل توانایی جستجو و تکثیر مقادیر بسیار اندک DNA استفاده شد. از طرفی تشخیص مایکوباکتریوم آویوم پاراتوبرکلوزیس در مدفوع، از اهمیت ویژه­ای برخوردار ­است زیرا، مهم‌ترین راه انتشار این باکتری پخش مدفوع حیوانات آلوده در محیط می‌باشد. یکی از مزایای روش به­کار رفته در این مطالعه این است که به صورت مستقیم و بدون نیاز به کشت و یا اطلاع از وضعیت بالینی و کلنیکی دام می­توان به بررسی نمونه­های مدفوعی گرفته­شده از دام پرداخت و با اطمینان زیادی سلامت و یا آلودگی دام مربوط را نسبت به مایکوباکتریوم آویوم پاراتوبرکلوزیس گزارش نمود. با توجه به اینکه حیوان آلوده علائم بالینی خاصی از خود بروز نمی­دهد و از سوی دیگر به­دلیل بقای مایکوباکتریوم آویوم پاراتوبرکلوزیس در طول پاستوریزاسیون، بنابراین تشخیص سریع و دقیق این باکتری با استفاده از روش Nested–PCR اهمیت زیادی دارد. (دوستی و مشکلانی، 1388). نتایج تحقیق حاضر نمایانگر توانایی و دقت آزمایش طراحی شده برای تشخیص و تکثیر مناسب ژن IS900 در مخلوط واکنش می­باشد. به دلیل آن­که مایکوباکتریوم آویوم پاراتوبرکلوزیس دارای 10 کپی از ژن IS900 می­باشد، لذا تکثیر ژن مذکور با PCR توان تشخیص بیماری یون را حتی در مراحل اولیه بیماری که تعداد میکروارگانیسم­ها ناچیز است، دارا می­باشد. هم­چنین در تعیین توالی­یابی و بررسی تحت­ژنوتیپ­های ژن­های  GyrBوGyrA  مشاهده شد که سویه­های ما 99 درصد با سویه­های ثبت شده در بانک ژنی NCBI هم­خوانی دارد. با توجه به نتایج به دست آمده مشاهده شد جدایه‌های  KJ629114 و AE016958 بیشترین شباهت و جدایه CP000325  بیشترین تفاوت را با جدایه­های حاصل از این تحقیق در ژن GyrA دارند. در مورد ژنGyrB  نیز بیشترین شباهت مربوط به جدایه AE016985 ،CP005928   و   CP009614 و بیشترین تفاوت مربوط به جدایهGU143884  می­باشد که نتایج تحقیقات قبلی با نتایج به­دست ­آمده از پژوهش حاضر هم­خوانی دارد.

   پیشنهاد می­شود توالی مناطق دیگری از ژنوم مربوط به جدایه­های مورد مطالعه در این تحقیق و مقایسه آنها با یکدیگر به منظور شناخت بیشتر قرابت و تفاوت­های فیلوژنتیکی موجود در جدایه­های انسانی و دامی صورت پذیرد. همچنین توصیه می شود، بررسی مولکولی اپیدمیولوژی جدایه­های دامی در سایر مناطق ایران انجام گیرد.

  • حسنی طباطبایی، ع. و فیروزی، ر. (1380). بیماری‌های باکتریایی دام. انتشارات دانشگاه تهران، صفحه: 414.
  • حق­خواه، م.، انصاری لاری، م.، نوین باهران، ا. و بهرامی، ا. (1387). تعیین میزان شیوع مایکوباکتریوم پاراتوبرکلوزیس بر روی نمونه‌های تانک شیر به­روش واکنش زنجیره‌ای پلیمراز در استان فارس. شماره 88، صفحات: 13-8.
  • دوستی، ع. و مشکلانی، س. (1388). تشخیص مایکوباکتریوم پاراتوبرکلوزیس به روش واکنش زنجیره‌ای پلیمراز آشیانه‌ای در گاوهای شیری مشکوک به بیماری یون. مجله دنیای میکروب‎ها، سال دوم، شماره 1، صفحات: 22-19.
  • دیلمقانی، م.، یوسف بیگی، ق.، کاظم نیا،ع. و اسمعیل نژاد، ب. (1390). جداسازی MAP از گاوان منطقه ارومیه. مجله پژوهش و سازندگی ، شماره 93، صفحات: 17-13.
  • سیدین، س.، تاجبخش، ح. و زهرایی صالحی، ت. (1389). شناسایی مایکوباکتریوم آویوم تحت­گونه پاراتوبرکلوزیس در نمونه‌های مدفوع گاوهای نژاد هلشتاین- فریزین با استفاده از روش‌های کشت و مولکولی. مجله تحقیقات دامپزشکی، دوره 65، شماره 2، صفحات: 140-135.
  • شرافتی چالشتری، ر.، شاکریان، ا.، ممتاز، ح. و شرافتی چالشتری، ف. (1388). شناسایی میکوباکتریوم پاراتوبرکلوزیس به­روش واکنش زنجیره‌ای پلیمراز در نمونه‌های شیر خام گاوهای شهرکرد. مجله علوم آزمایشگاهی، دوره3، شماره 1، صفحات: 20-15.
  • نصیری، م.، جهاندار، م.، سلطانی، م.، مهدوی، م. و دوستی، م. (1391). شناسایی و تعیین سویه مایکوباکتریوم پاراتوبرکلوزیس به­روش PCR و REA بر اساس قطعات درون جای­گیر IS900  و IS1311. مجله بیوتکنولوژی کشاورزی، دوره 4، شماره 1، صفحات: 96-83.
    • Alexander, D.C., Turenne, C.Y. and Behr, Ma. (2009). Insertion and deletion events that define the pathogen Mycobacterium avium subsp. paratuberculosis. Journal of Bacteriology, 19(3): 1018-1025.
    • Beaudeau, F., Belliard, M., Joly, A. and Seegers, H. (2007). Reduction in milk yield associated with Mycobacterium avium subspecies paratuberculosis (MAP) infection in dairy Cows. Veterinary Research, 38(4): 625-634.
    • Berghaus, R.D., Lombard, J.E., Gardner, I.A. and Farver, T.B. (2005). Factor analysis of a Johne's disease risk assessment questionnaire with evaluation of factor scores and a subset of original questions as predictors of observed clinical paratuberculosis. Preventive Veterinary Medicine, 12: 291-309.
    • D' Haese, E., Dumon, I., werbrouck, H.J. and Heman, L. (2005). Improved detection of Mycobacterium paratuberculosis in milk. The Journal of Dairy Research, 72: 125-128.
    • De Meneghi, D., Nebbia, P., Robino, P. and zoppi, S. (2006).detection and excretion pattern of Mycobacterium avium subspecies paratuberculosis of milk of asymptomatic sheep and goats by nested-PCR. Small Ruminant Research, 6: 116-120.
    • Donaghy, J.A., Rowe, M.T., Rademaker, J.L., Hammer, P., Herman. L. and De Jomghe, V. (2008).  An inter-Laboratoty ring trial for the detection and isolation of Mycobacterium avium subsp. paratuberculosis from raw milk artificially contaminated with naturally infected faeces. Journal of Food Microbiology, 25(1): 128-135.
    • Douarre, P.E., Cashman, W., Buckley, J., Coffey, A. and O'Mahony, J.M. (2010). Isolation and detection of Mycobacterium avium ssp. paratuberculosis (MAP) from cattle in Ireland using both traditional culture and molecular based methods. Gut Pathogens, 2: 110.
    • Elena, C., Lucia, D.J., Lucas, D. and Alicia, A. (2012). Progress in molecular typing of Mycobacterium avium subspecies paratuberculosis; Research in Veterinary Science, 92: 169-179.
    • Eriks, I.S., Munck, K.T., Besser, T.E., Cator, G.H. and Kapur, V. (1996). Rapid differentiation of Mycobacterium avium and Mycobacterium paratuberculosis by PCR and restriction enzyme analysis. Journal of Clinical Microbiology, 34: 734-737.
    • Franck, B., Iker, A.S., Thierry, C., Joseba, M., Ramón, A. and Karen, S. (2012). Inter- and Intra-subtype genotypic differences that differentiate Mycobacterium avium subspecies paratuberculosis strains. Biet et al., BMC Microbiology, 12: 1471-2180.
    • Jagdeep, S.A., Neelam, S., Krishnamoorthy, N., Vani, B., Shoorvir, S. and Swati, S. (2009). Genomic analysis of local isolate of Mycobacterium avium subspecies paratuberculosis. Veterinary Microbiology, 134: 375-382.
    • James, W., Torsten, S., Dieter, M., Josef, W. and Wojtek, P. (2011). Exploring the zoonotic potential of Mycobacterium avium subspecies paratuberculosis through comparative genomics. PLoS ONE, www.plosone.org. 6(7): 221-171.
    • John, P. (2012). Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association. Bannantine et al., BMC Genomics, 13(89): 1471-2164.
    • Jorgensen, J.B. and Jensen, P.T. (1978). Enzyme–linked immunosorbent assay (ELISA) for detection of antibody-ies to Mycobacterium paratuberculosis in cattle. Acta Veterinaria Scandinavica, 19: 310-312.
    • O'Mahony, J. and Hill, C. (2004). Rapid real-time PCR assay for detection and quantitation of Mycobacterium avium subsp. paratuberculosis DNA in artificially contaminated milk. Applied and Environmental Microbiology, 70: 4561-4568.
    • Quinn, P.J. (2002). Veterinary Microbiology and Microbial Disease.  1st ed., USA: Blackwell Science Company, pp: 97-105.
    • Stable, J., Wells, S. and Wagner, B. (2002). Relationships between fecal culture, ELISA, and bulktank milk test results for John's disease in us dairy herds. Journal of Dairy Science, 85: 525-533.
    • Singh, S.V. (2007). Evaluation of highly sensitive indigenous milk ELISA kit with fecal culture, milk culture and fecal- PCR for the diagnosis of bovine Johne’s disease (BJD) in India. Comparative Immunology, Microbiology and Infectious Diseases, 30(3): 175-186.
    • Slana, I., Kralik, P., Karalova, A. and Pavlik, I. (2008). On-farm spread of Mycobacterium avium ssp. paratuberculosis in raw milk studied by IS900 and F57 competitive real time quantitative PCR and culture examination. International Journal of Food Microbiology, 128: 250-257.
    • Vary, P.H., Andersen, P.R., Green, E., Hermon-Taylor, J. and Mc Fadden, J.J. (1990).   Use of highly specific DNA probe and the polymerase chain reaction to detect Mycobacterium paratuberculosis in Jone's disease. Journal of Clinical Microbiology, 28: 933-937.
    • Vasnick, E., Vercammen, F., Bauwens, L., D'Haese, E., Nelis, H. and Geysen, D. (2005). A survey for Mycobacterium avium subspecies partuberculosis in the Royal zoological society of Abtwerp. Veterinary Journal, 170: 249-256.
    • Verlaine, J., Michelle, M., Gehringer,  M., Mitchell, G. and Brett, A.  (2011). How accurately can we detect Mycobacterium avium ssp. paratuberculosis infection? Journal of Microbiological Methods, 85: 1-8.
    • Wells, S.J. (2006). Evaluation of a rapid fecal PCR test for detection of Mycobacterium avium subsp paratuberculosis in dairy cattle.  Clinical and Vaccine Immunology. 13(10): 123-125.